Human ALB/FDAHT/ HSA ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_000477)

Pre-made Human ALB/FDAHT/ HSA Non-Viral expression plasmid (overexpression vector) for mouse ALB overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to ALB/FDAHT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC001123 Human ALB Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC001123
Gene Name ALB
Accession Number NM_000477
Gene ID 213
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1830 bp
Gene Alias FDAHT, HSA, PRO0883, PRO0903, PRO1341
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTCTCTTTAGCTCGGCTTATTCCAGGGGTGTGTTTCGTCGAGATGCACACAAGAGTGAGGTTGCTCATCGGTTTAAAGATTTGGGAGAAGAAAATTTCAAAGCCTTGGTGTTGATTGCCTTTGCTCAGTATCTTCAGCAGTGTCCATTTGAAGATCATGTAAAATTAGTGAATGAAGTAACTGAATTTGCAAAAACATGTGTTGCTGATGAGTCAGCTGAAAATTGTGACAAATCACTTCATACCCTTTTTGGAGACAAATTATGCACAGTTGCAACTCTTCGTGAAACCTATGGTGAAATGGCTGACTGCTGTGCAAAACAAGAACCTGAGAGAAATGAATGCTTCTTGCAACACAAAGATGACAACCCAAACCTCCCCCGATTGGTGAGACCAGAGGTTGATGTGATGTGCACTGCTTTTCATGACAATGAAGAGACATTTTTGAAAAAATACTTATATGAAATTGCCAGAAGACATCCTTACTTTTATGCCCCGGAACTCCTTTTCTTTGCTAAAAGGTATAAAGCTGCTTTTACAGAATGTTGCCAAGCTGCTGATAAAGCTGCCTGCCTGTTGCCAAAGCTCGATGAACTTCGGGATGAAGGGAAGGCTTCGTCTGCCAAACAGAGACTCAAGTGTGCCAGTCTCCAAAAATTTGGAGAAAGAGCTTTCAAAGCATGGGCAGTAGCTCGCCTGAGCCAGAGATTTCCCAAAGCTGAGTTTGCAGAAGTTTCCAAGTTAGTGACAGATCTTACCAAAGTCCACACGGAATGCTGCCATGGAGATCTGCTTGAATGTGCTGATGACAGGGCGGACCTTGCCAAGTATATCTGTGAAAATCAAGATTCGATCTCCAGTAAACTGAAGGAATGCTGTGAAAAACCTCTGTTGGAAAAATCCCACTGCATTGCCGAAGTGGAAAATGATGAGATGCCTGCTGACTTGCCTTCATTAGCTGCTGATTTTGTTGAAAGTAAGGATGTTTGCAAAAACTATGCTGAGGCAAAGGATGTCTTCCTGGGCATGTTTTTGTATGAATATGCAAGAAGGCATCCTGATTACTCTGTCGTGCTGCTGCTGAGACTTGCCAAGACATATGAAACCACTCTAGAGAAGTGCTGTGCCGCTGCAGATCCTCATGAATGCTATGCCAAAGTGTTCGATGAATTTAAACCTCTTGTGGAAGAGCCTCAGAATTTAATCAAACAAAATTGTGAGCTTTTTGAGCAGCTTGGAGAGTACAAATTCCAGAATGCGCTATTAGTTCGTTACACCAAGAAAGTACCCCAAGTGTCAACTCCAACTCTTGTAGAGGTCTCAAGAAACCTAGGAAAAGTGGGCAGCAAATGTTGTAAACATCCTGAAGCAAAAAGAATGCCCTGTGCAGAAGACTATCTATCCGTGGTCCTGAACCAGTTATGTGTGTTGCATGAGAAAACGCCAGTAAGTGACAGAGTCACCAAATGCTGCACAGAATCCTTGGTGAACAGGCGACCATGCTTTTCAGCTCTGGAAGTCGATGAAACATACGTTCCCAAAGAGTTTAATGCTGAAACATTCACCTTCCATGCAGATATATGCACACTTTCTGAGAAGGAGAGACAAATCAAGAAACAAACTGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAGCAACTGAAAGCTGTTATGGATGATTTCGCAGCTTTTGTAGAGAAGTGCTGCAAGGCTGACGATAAGGAGACCTGCTTTGCCGAGGAGGGTAAAAAACTTGTTGCTGCAAGTCAAGCTGCCTTAGGCTTATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-880 Pre-Made Izokibep Biosimilar, Bispecific, Anti-ALB;IL17A/IL17 Antibody: Anti-FDAHT/HSA/PRO0883/PRO0903/PRO1341;CTLA-8/CTLA8A therapeutic antibody
    Biosimilar GMP-Bios-ab-625 Pre-Made Vobarilizumab biosimilar, Bispecific Single Domains (VH-VH'), Anti-IL6R;ALB Antibody: Anti-CD126/HIES5/IL-1Ra/IL-6R/IL-6R-1/IL-6RA/IL6Q/IL6QTL/IL6RA/IL6RQ/gp80;FDAHT/HSA/PRO0883/PRO0903/PRO1341 therapeutic antibody
    Biosimilar GMP-Bios-INN-1022 Pre-Made Tifalibep Biosimilar, Bispecific, Anti-Alb;Fcgrt Antibody: Anti-FDAHT/HSA/PRO0883/PRO0903/PRO1341;FCRN/FcgammaRn/alpha-chain therapeutic antibody
    Biosimilar GMP-Bios-ab-281 Pre-Made Isecarosmab biosimilar, Bispecific Single Domains (VH-VH'), Anti-ADAMTSL5;ALB Antibody: Anti-THSD6;FDAHT/HSA/PRO0883/PRO0903/PRO1341 therapeutic antibody
    Biosimilar GMP-Bios-ab-419 Pre-Made Ozoralizumab biosimilar, Bispecific Single Domains (VH-VH'-VH), Anti-TNFA/TNF;ALB Antibody: Anti-DIF/TNF-alpha/TNFSF2/TNLG1F;FDAHT/HSA/PRO0883/PRO0903/PRO1341 therapeutic antibody
    Biosimilar GMP-Bios-INN-996 Pre-Made Sonelokimab Biosimilar, Bispecific, Anti-ALB;IL17A/IL17;IL17F Antibody: Anti-FDAHT/HSA/PRO0883/PRO0903/PRO1341;CTLA-8/CTLA8/IL-17A/ILA17;CANDF6/ML-1/ML1 therapeutic antibody
    Target Antibody GM-Tg-g-T63068-Ab Anti-ALBU/ ALB/ HSA functional antibody
    Target Antigen GM-Tg-g-T63068-Ag ALB protein
    ORF Viral Vector pGMPC001123 Human ALB Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001108 Human ALB Lentivirus plasmid
    ORF Viral Vector pGMLP003870 Human ALB Lentivirus plasmid
    ORF Viral Vector vGMLP001108 Human ALB Lentivirus particle
    ORF Viral Vector vGMLP003870 Human ALB Lentivirus particle


    Target information

    Target ID GM-T63068
    Target Name ALB
    Gene ID 213, 11657, 704892, 24186, 448843, 403550, 280717, 100034206
    Gene Symbol and Synonyms ALB,Alb-1,Alb1,Albza,BCL002,CSA,FDAHT,HSA,PRO0883,PRO0903,PRO1341
    Uniprot Accession P02768
    Uniprot Entry Name ALBU_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, INN Index
    Disease Nephropathy induced by other drugs, medicaments and biological substances, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Crohn's disease, Diabetic Nephropathy, IgA glomerulonephritis, Nephrotic syndrome, Obstructive sleep apnea (adult) (pediatric), Ovarian cancer, Pre-eclampsia, Pregnant state, Type 2 diabetes mellitus, Type 2 diabetes mellitus with diabetic nephropathy
    Gene Ensembl ENSG00000163631
    Target Classification Not Available

    This gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. Additionally, this protein exhibits an esterase-like activity with broad substrate specificity. The encoded preproprotein is proteolytically processed to generate the mature protein. A peptide derived from this protein, EPI-X4, is an endogenous inhibitor of the CXCR4 chemokine receptor. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.