Human PYCARD/ASC/CARD5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_013258)

Cat. No.: pGMPC001854
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PYCARD/ASC/CARD5 Non-Viral expression plasmid (overexpression vector) for mouse PYCARD overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to PYCARD/ASC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001854
Gene Name PYCARD
Accession Number NM_013258
Gene ID 29108
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 588 bp
Gene Alias ASC,CARD5,TMS,TMS-1,TMS1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag Null
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCGCGCGCGCGACGCCATCCTGGATGCGCTGGAGAACCTGACCGCCGAGGAGCTCAAGAAGTTCAAGCTGAAGCTGCTGTCGGTGCCGCTGCGCGAGGGCTACGGGCGCATCCCGCGGGGCGCGCTGCTGTCCATGGACGCCTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCTCTGGAGCCGCGCCAGCTGGGATCCAGGCCCCTCCTCAGTCGGCAGCCAAGCCAGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGA
ORF Protein Sequence MGRARDAILDALENLTAEELKKFKLKLLSVPLREGYGRIPRGALLSMDALDLTDKLVSFYLETYGAELTANVLRDMGLQEMAGQLQAATHQGSGAAPAGIQAPPQSAAKPGLHFIDQHRAALIARVTNVEWLLDALYGKVLTDEQYQAVRAEPTNPSKMRKLFSFTPAWNWTCKDLLLQALRESQSYLVEDLERS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0440-Ab Anti-ASC/ PYCARD/ CARD5 functional antibody
    Target Antigen GM-Tg-g-SE0440-Ag PYCARD protein
    ORF Viral Vector pGMLP004754 Human PYCARD Lentivirus plasmid
    ORF Viral Vector pGMPC001854 Human PYCARD Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004754 Human PYCARD Lentivirus particle


    Target information

    Target ID GM-SE0440
    Target Name PYCARD
    Gene ID 29108, 713563, 100856347
    Gene Symbol and Synonyms ASC,CARD5,PYCARD,TMS,TMS-1,TMS1
    Uniprot Accession Q9ULZ3
    Uniprot Entry Name ASC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000103490
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.