Human PYCARD/ASC/CARD5 ORF/cDNA clone-Lentivirus particle (NM_145182)
Cat. No.: vGMLP004754
Pre-made Human PYCARD/ASC/CARD5 Lentiviral expression plasmid for PYCARD lentivirus packaging, PYCARD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PYCARD/ASC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004754 | Human PYCARD Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004754 |
| Gene Name | PYCARD |
| Accession Number | NM_145182 |
| Gene ID | 29108 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 531 bp |
| Gene Alias | ASC,CARD5,TMS,TMS-1,TMS1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGGCGCGCGCGCGACGCCATCCTGGATGCGCTGGAGAACCTGACCGCCGAGGAGCTCAAGAAGTTCAAGCTGAAGCTGCTGTCGGTGCCGCTGCGCGAGGGCTACGGGCGCATCCCGCGGGGCGCGCTGCTGTCCATGGACGCCTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGA |
| ORF Protein Sequence | MGRARDAILDALENLTAEELKKFKLKLLSVPLREGYGRIPRGALLSMDALDLTDKLVSFYLETYGAELTANVLRDMGLQEMAGQLQAATHQGLHFIDQHRAALIARVTNVEWLLDALYGKVLTDEQYQAVRAEPTNPSKMRKLFSFTPAWNWTCKDLLLQALRESQSYLVEDLERS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0440-Ab | Anti-ASC/ PYCARD/ CARD5 functional antibody |
| Target Antigen | GM-Tg-g-SE0440-Ag | PYCARD protein |
| ORF Viral Vector | pGMLP004754 | Human PYCARD Lentivirus plasmid |
| ORF Viral Vector | pGMPC001854 | Human PYCARD Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP004754 | Human PYCARD Lentivirus particle |
Target information
| Target ID | GM-SE0440 |
| Target Name | PYCARD |
| Gene ID | 29108, 713563, 100856347 |
| Gene Symbol and Synonyms | ASC,CARD5,PYCARD,TMS,TMS-1,TMS1 |
| Uniprot Accession | Q9ULZ3 |
| Uniprot Entry Name | ASC_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000103490 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


