Human TXN/TRDX/ TRX ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_003329.4)

Pre-made Human TXN/TRDX/ TRX Adeno-associated virus particle for TXN in-vivo study, mechanism of action (MOA) research and TXN-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to TXN/TRDX products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000969 Human TXN Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000969
Gene Name TXN
Accession Number NM_003329.4
Gene ID 7295
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 318 bp
Gene Alias TRDX, TRX, TRX1, Trx80
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGAAGCAGATCGAGAGCAAGACTGCTTTTCAGGAAGCCTTGGACGCTGCAGGTGATAAACTTGTAGTAGTTGACTTCTCAGCCACGTGGTGTGGGCCTTGCAAAATGATCAAGCCTTTCTTTCATTCCCTCTCTGAAAAGTATTCCAACGTGATATTCCTTGAAGTAGATGTGGATGACTGTCAGGATGTTGCTTCAGAGTGTGAAGTCAAATGCATGCCAACATTCCAGTTTTTTAAGAAGGGACAAAAGGTGGGTGAATTTTCTGGAGCCAATAAGGAAAAGCTTGAAGCCACCATTAATGAATTAGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85616-Ab Anti-THIO/ TXN/ TRDX functional antibody
    Target Antigen GM-Tg-g-T85616-Ag TXN protein
    ORF Viral Vector pGMLV001614 Rat Txn1 Lentivirus plasmid
    ORF Viral Vector pGMAD000153 Human TXN Adenovirus plasmid
    ORF Viral Vector pGMAD000538 Rat Txn1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000880 Rat Txn1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000969 Human TXN Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000200 Human TXN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000876 Human TXN Lentivirus plasmid
    ORF Viral Vector vGMLV001614 Rat Txn1 Lentivirus particle
    ORF Viral Vector vGMAD000153 Human TXN Adenovirus particle
    ORF Viral Vector vGMAD000538 Rat Txn1 Adenovirus particle
    ORF Viral Vector vGMAAV000880 Rat Txn1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000969 Human TXN Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP000876 Human TXN Lentivirus particle


    Target information

    Target ID GM-T85616
    Target Name TXN
    Gene ID 7295, 22166, 712587, 116484, 101090655, 474798, 280950, 100033827
    Gene Symbol and Synonyms ADF,TRDX,TRX,TRX1,Trx80,TXN,TXN1
    Uniprot Accession P10599
    Uniprot Entry Name THIO_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000136810
    Target Classification Not Available

    The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.