Human CLEC1B/1810061I13Rik/CLEC2 ORF/cDNA clone-Adenovirus particle (NM_001099431.1)
Cat. No.: vGMAD000045
Pre-made Human CLEC1B/1810061I13Rik/CLEC2 Adenovirus for CLEC1B overexpression in-vitro and in-vivo. The CLEC1B adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CLEC1B-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
CLEC1B/1810061I13Rik products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000045 | Human CLEC1B Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000045 |
Gene Name | CLEC1B |
Accession Number | NM_001099431.1 |
Gene ID | 51266 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 591 bp |
Gene Alias | 1810061I13Rik,CLEC2,CLEC2B,PRO1384,QDED721 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGCTGTCATGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACAGGAACTCTGCAACAATTAGCAAAGCGCTTCTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTTTCAAAGGTCATAAATGCAGCCCCTGTGACACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAGAGAGTAAGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATTGACAACCGGAACATTGTGGAGTACATCAAAGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCCAGAAGTCGAATGAGGTCTGGAAGTGGGAGGATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGAAGATGGAAAAGGAAATATGAATTGTGCTTATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAACAAACATTATTTAATGTGTGAGAGGAAGGCTGGCATGACCAAGGTGGACCAACTACCTTAA |
ORF Protein Sequence | MQDEDGYITLNIKTRKPALISAVMQRNYLQGENENRTGTLQQLAKRFCQYVVKQSELKGTFKGHKCSPCDTNWRYYGDSCYGFFRHNLTWEESKQYCTDMNATLLKIDNRNIVEYIKARTHLIRWVGLSRQKSNEVWKWEDGSVISENMFEFLEDGKGNMNCAYFHNGKMHPTFCENKHYLMCERKAGMTKVDQLP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0292-Ab | Anti-CLC1B/ CLEC1B/ 1810061I13Rik monoclonal antibody |
Target Antigen | GM-Tg-g-MP0292-Ag | CLEC1B VLP (virus-like particle) |
ORF Viral Vector | pGMLV001230 | Human CLEC1B Lentivirus plasmid |
ORF Viral Vector | pGMAD000045 | Human CLEC1B Adenovirus plasmid |
ORF Viral Vector | vGMLV001230 | Human CLEC1B Lentivirus particle |
ORF Viral Vector | vGMAD000045 | Human CLEC1B Adenovirus particle |
Target information
Target ID | GM-MP0292 |
Target Name | CLEC1B |
Gene ID | 51266, 56760, 717404, 500336, 109491361, 784092, 100053758 |
Gene Symbol and Synonyms | 1810061I13Rik,Clec-2,CLEC1B,CLEC2,CLEC2B,PRO1384,QDED721,RGD1563517 |
Uniprot Accession | Q9P126 |
Uniprot Entry Name | CLC1B_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000165682 |
Target Classification | Not Available |
Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.