Human CLEC1B/1810061I13Rik/CLEC2 ORF/cDNA clone-Adenovirus particle (NM_001099431.1)

Cat. No.: vGMAD000045

Pre-made Human CLEC1B/1810061I13Rik/CLEC2 Adenovirus for CLEC1B overexpression in-vitro and in-vivo. The CLEC1B adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CLEC1B-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CLEC1B/1810061I13Rik products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000045 Human CLEC1B Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000045
Gene Name CLEC1B
Accession Number NM_001099431.1
Gene ID 51266
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 591 bp
Gene Alias 1810061I13Rik,CLEC2,CLEC2B,PRO1384,QDED721
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGCTGTCATGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACAGGAACTCTGCAACAATTAGCAAAGCGCTTCTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTTTCAAAGGTCATAAATGCAGCCCCTGTGACACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAGAGAGTAAGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATTGACAACCGGAACATTGTGGAGTACATCAAAGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCCAGAAGTCGAATGAGGTCTGGAAGTGGGAGGATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGAAGATGGAAAAGGAAATATGAATTGTGCTTATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAACAAACATTATTTAATGTGTGAGAGGAAGGCTGGCATGACCAAGGTGGACCAACTACCTTAA
ORF Protein Sequence MQDEDGYITLNIKTRKPALISAVMQRNYLQGENENRTGTLQQLAKRFCQYVVKQSELKGTFKGHKCSPCDTNWRYYGDSCYGFFRHNLTWEESKQYCTDMNATLLKIDNRNIVEYIKARTHLIRWVGLSRQKSNEVWKWEDGSVISENMFEFLEDGKGNMNCAYFHNGKMHPTFCENKHYLMCERKAGMTKVDQLP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0292-Ab Anti-CLC1B/ CLEC1B/ 1810061I13Rik monoclonal antibody
    Target Antigen GM-Tg-g-MP0292-Ag CLEC1B VLP (virus-like particle)
    ORF Viral Vector pGMLV001230 Human CLEC1B Lentivirus plasmid
    ORF Viral Vector pGMAD000045 Human CLEC1B Adenovirus plasmid
    ORF Viral Vector vGMLV001230 Human CLEC1B Lentivirus particle
    ORF Viral Vector vGMAD000045 Human CLEC1B Adenovirus particle


    Target information

    Target ID GM-MP0292
    Target Name CLEC1B
    Gene ID 51266, 56760, 717404, 500336, 109491361, 784092, 100053758
    Gene Symbol and Synonyms 1810061I13Rik,Clec-2,CLEC1B,CLEC2,CLEC2B,PRO1384,QDED721,RGD1563517
    Uniprot Accession Q9P126
    Uniprot Entry Name CLC1B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000165682
    Target Classification Not Available

    Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.