Human KLF4/EZF/ GKLF ORF/cDNA clone-Adenovirus particle (NM_004235.6)

Pre-made Human KLF4/EZF/ GKLF Adenovirus for KLF4 overexpression in-vitro and in-vivo. The KLF4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified KLF4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to KLF4/EZF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000806 Human KLF4 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000806
Gene Name KLF4
Accession Number NM_004235.6
Gene ID 9314
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1440 bp
Gene Alias EZF, GKLF
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACCGAGGAGTTCAACGATCTCCTGGACCTGGACTTTATTCTCTCCAATTCGCTGACCCATCCTCCGGAGTCAGTGGCCGCCACCGTGTCCTCGTCAGCGTCAGCCTCCTCTTCGTCGTCGCCGTCGAGCAGCGGCCCTGCCAGCGCGCCCTCCACCTGCAGCTTCACCTATCCGATCCGGGCCGGGAACGACCCGGGCGTGGCGCCGGGCGGCACGGGCGGAGGCCTCCTCTATGGCAGGGAGTCCGCTCCCCCTCCGACGGCTCCCTTCAACCTGGCGGACATCAACGACGTGAGCCCCTCGGGCGGCTTCGTGGCCGAGCTCCTGCGGCCAGAATTGGACCCGGTGTACATTCCGCCGCAGCAGCCGCAGCCGCCAGGTGGCGGGCTGATGGGCAAGTTCGTGCTGAAGGCGTCGCTGAGCGCCCCTGGCAGCGAGTACGGCAGCCCGTCGGTCATCAGCGTCAGCAAAGGCAGCCCTGACGGCAGCCACCCGGTGGTGGTGGCGCCCTACAACGGCGGGCCGCCGCGCACGTGCCCCAAGATCAAGCAGGAGGCGGTCTCTTCGTGCACCCACTTGGGCGCTGGACCCCCTCTCAGCAATGGCCACCGGCCGGCTGCACACGACTTCCCCCTGGGGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTCTTGAGGAAGTGCTGAGCAGCAGGGACTGTCACCCTGCCCTGCCGCTTCCTCCCGGCTTCCATCCCCACCCGGGGCCCAATTACCCATCCTTCCTGCCCGATCAGATGCAGCCGCAAGTCCCGCCGCTCCATTACCAAGAGCTCATGCCACCCGGTTCCTGCATGCCAGAGGAGCCCAAGCCAAAGAGGGGAAGACGATCGTGGCCCCGGAAAAGGACCGCCACCCACACTTGTGATTACGCGGGCTGCGGCAAAACCTACACAAAGAGTTCCCATCTCAAGGCACACCTGCGAACCCACACAGGTGAGAAACCTTACCACTGTGACTGGGACGGCTGTGGATGGAAATTCGCCCGCTCAGATGAACTGACCAGGCACTACCGTAAACACACGGGGCACCGCCCGTTCCAGTGCCAAAAATGCGACCGAGCATTTTCCAGGTCGGACCACCTCGCCTTACACATGAAGAGGCATTTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T81916-Ab Anti-KLF4 monoclonal antibody
    Target Antigen GM-Tg-g-T81916-Ag KLF4 protein
    ORF Viral Vector pGMLV000247 Human KLF4 Lentivirus plasmid
    ORF Viral Vector pGMAD000164 Human KLF4 Adenovirus plasmid
    ORF Viral Vector pGMAD000806 Human KLF4 Adenovirus plasmid
    ORF Viral Vector pGMPC001122 Human KLF4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000247 Human KLF4 Lentivirus particle
    ORF Viral Vector vGMAD000164 Human KLF4 Adenovirus particle
    ORF Viral Vector vGMAD000806 Human KLF4 Adenovirus particle
    ORF Viral Vector pGMLV002172 Human KLF4 Lentivirus plasmid
    ORF Viral Vector pGMLV002425 Human KLF4 Lentivirus plasmid


    Target information

    Target ID GM-T81916
    Target Name KLF4
    Gene ID 9314, 16600, 711169, 114505, 100379626, 481657, 520842, 100054047
    Gene Symbol and Synonyms EZF,GKLF,KLF4,Zie
    Uniprot Accession O43474
    Uniprot Entry Name KLF4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000136826
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.