Human TP53/BCC7/ BMFS5 ORF/cDNA clone-Adenovirus particle (NM_000546.6)

Pre-made Human TP53/BCC7/ BMFS5 Adenovirus for TP53 overexpression in-vitro and in-vivo. The TP53 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TP53-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TP53 Y220C/TP53/BCC7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000926 Human TP53 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000926
Gene Name TP53
Accession Number NM_000546.6
Gene ID 7157
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1182 bp
Gene Alias BCC7, BMFS5, LFS1, P53, TRP53
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69823-Ab Anti-TP53 Y220C monoclonal antibody
    Target Antigen GM-Tg-g-T69823-Ag TP53 Y220C/TP53 protein
    ORF Viral Vector pGMLV001164 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMLV001491 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMAD000013 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMAD000347 Rat Tp53 Adenovirus plasmid
    ORF Viral Vector pGMAD000926 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMAAV000014 Human TP53 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000186 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000925 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000942 Rat Tp53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001097 Rat Tp53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000334 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-014 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-154 Human TP53 Adenovirus plasmid
    ORF Viral Vector vGMLV001164 Human TP53 Lentivirus particle
    ORF Viral Vector vGMLV001491 Human TP53 Lentivirus particle
    ORF Viral Vector vGMAD000013 Human TP53 Adenovirus particle
    ORF Viral Vector vGMAD000347 Rat Tp53 Adenovirus particle
    ORF Viral Vector vGMAD000926 Human TP53 Adenovirus particle
    ORF Viral Vector vGMAAV000014 Human TP53 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000334 Human TP53 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-014 Human TP53 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-154 Human TP53 Adenovirus particle
    ORF Viral Vector pGMLV002147 Human TP53 Lentivirus plasmid


    Target information

    Target ID GM-T69823
    Target Name TP53 Y220C
    Gene ID 7157, 22059, 716170, 24842, 493847, 403869, 281542, 100062044
    Gene Symbol and Synonyms bbl,BCC7,bfy,bhy,BMFS5,LFS1,p44,P53,TP53,TRP53
    Uniprot Accession P04637
    Uniprot Entry Name P53_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Lung Cancer, lung cancers, Lung cancer, Lung, Colon cancer, Bone metastasis, Liver neoplasms, Lung neoplasms
    Gene Ensembl ENSG00000141510
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.