Human TP53/LFS1/ p53 ORF/cDNA clone-Adenovirus particle (BC003596)
Pre-made Human TP53/LFS1/ p53 Adenovirus for TP53 overexpression in-vitro and in-vivo. The TP53 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TP53-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to TP53 Y220C/TP53/LFS1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000334 | Human TP53 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000334 |
Gene Name | TP53 |
Accession Number | BC003596 |
Gene ID | 7157 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1182 bp |
Gene Alias | LFS1, p53, TRP53 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTGCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T69823 |
Target Name | TP53 Y220C |
Gene ID | 7157, 22059, 716170, 24842, 493847, 403869, 281542, 100062044 |
Gene Symbol and Synonyms | bbl,BCC7,bfy,bhy,BMFS5,LFS1,p44,P53,TP53,TRP53 |
Uniprot Accession | P04637 |
Uniprot Entry Name | P53_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Lung Cancer, lung cancers, Lung cancer, Lung, Colon cancer, Bone metastasis, Liver neoplasms, Lung neoplasms |
Gene Ensembl | ENSG00000141510 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.