Human SERPINA1/A1A/ A1AT ORF/cDNA clone-Adenovirus particle (BC011991)

Pre-made Human SERPINA1/A1A/ A1AT Adenovirus for SERPINA1 overexpression in-vitro and in-vivo. The SERPINA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SERPINA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to SERPINA1/A1A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000441 Human SERPINA1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000441
Gene Name SERPINA1
Accession Number BC011991
Gene ID 5265
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1257 bp
Gene Alias A1A, A1AT, AAT, MGC23330, MGC9222, PI1, PRO2275
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCTTGTTCCTCAGCGAGGGCCTGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACCACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACGAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGACCAAAATACCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28265-Ab Anti-A1AT/ SERPINA1/ A1A functional antibody
    Target Antigen GM-Tg-g-T28265-Ag SERPINA1 protein
    ORF Viral Vector pGMLV001493 Human SERPINA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001572 Human SERPINA1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000168 Human SERPINA1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003894 Human SERPINA1 Lentivirus plasmid
    ORF Viral Vector pGMAP000441 Human SERPINA1 Adenovirus plasmid
    ORF Viral Vector vGMLV001493 Human SERPINA1 Lentivirus particle
    ORF Viral Vector vGMLV001572 Human SERPINA1 Lentivirus particle
    ORF Viral Vector vGMAAV000168 Human SERPINA1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003894 Human SERPINA1 Lentivirus particle
    ORF Viral Vector vGMAP000441 Human SERPINA1 Adenovirus particle
    ORF Viral Vector pGMLV002164 Human SERPINA1 Lentivirus plasmid


    Target information

    Target ID GM-T28265
    Target Name SERPINA1
    Gene ID 5265, 701361, 480422, 280699
    Gene Symbol and Synonyms A1A,A1AT,AAT,alpha1AT,nNIF,PI,PI1,PRO2275,SERPINA1
    Uniprot Accession P01009
    Uniprot Entry Name A1AT_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Malignant neoplasm of bladder, IgA glomerulonephritis, Nephrotic syndrome with focal and segmental glomerular lesions, Diabetic Nephropathy, Contrast - Induced Nephropathy, Congenital occlusion of ureteropelvic junction, Calculus of kidney, Nephrotic syndrome, Acute pancreatitis, Juvenile arthritis, Urinary bladder urothelial carcinoma, Type 2 diabetes mellitus with diabetic nephropathy, protease
    Gene Ensembl ENSG00000197249
    Target Classification Not Available

    The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.