Human SERPINA1/A1A/ A1AT ORF/cDNA clone-Lentivirus particle (NM_000295.5)
Pre-made Human SERPINA1/A1A/ A1AT Lentiviral expression plasmid for SERPINA1 lentivirus packaging, SERPINA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SERPINA1/A1A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001572 | Human SERPINA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001572 |
Gene Name | SERPINA1 |
Accession Number | NM_000295.5 |
Gene ID | 5265 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1257 bp |
Gene Alias | A1A, A1AT, AAT, alpha1AT, nNIF, PI, PI1, PRO2275 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCCTGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACCACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACGAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATACCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28265-Ab | Anti-A1AT/ SERPINA1/ A1A functional antibody |
Target Antigen | GM-Tg-g-T28265-Ag | SERPINA1 protein |
ORF Viral Vector | pGMLV001493 | Human SERPINA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001572 | Human SERPINA1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000168 | Human SERPINA1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP003894 | Human SERPINA1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000441 | Human SERPINA1 Adenovirus plasmid |
ORF Viral Vector | vGMLV001493 | Human SERPINA1 Lentivirus particle |
ORF Viral Vector | vGMLV001572 | Human SERPINA1 Lentivirus particle |
ORF Viral Vector | vGMAAV000168 | Human SERPINA1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP003894 | Human SERPINA1 Lentivirus particle |
ORF Viral Vector | vGMAP000441 | Human SERPINA1 Adenovirus particle |
ORF Viral Vector | pGMLV002164 | Human SERPINA1 Lentivirus plasmid |
Target information
Target ID | GM-T28265 |
Target Name | SERPINA1 |
Gene ID | 5265, 701361, 480422, 280699 |
Gene Symbol and Synonyms | A1A,A1AT,AAT,alpha1AT,nNIF,PI,PI1,PRO2275,SERPINA1 |
Uniprot Accession | P01009 |
Uniprot Entry Name | A1AT_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Malignant neoplasm of bladder, IgA glomerulonephritis, Nephrotic syndrome with focal and segmental glomerular lesions, Diabetic Nephropathy, Contrast - Induced Nephropathy, Congenital occlusion of ureteropelvic junction, Calculus of kidney, Nephrotic syndrome, Acute pancreatitis, Juvenile arthritis, Urinary bladder urothelial carcinoma, Type 2 diabetes mellitus with diabetic nephropathy, protease |
Gene Ensembl | ENSG00000197249 |
Target Classification | Not Available |
The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.