Human ADIPOQ/ACRP30/ adiponectin ORF/cDNA clone-Adenovirus particle (BC096310)
Pre-made Human ADIPOQ/ACRP30/ adiponectin Adenovirus for ADIPOQ overexpression in-vitro and in-vivo. The ADIPOQ adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ADIPOQ-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to ADIPOQ/ACRP30 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000564 | Human ADIPOQ Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000564 |
Gene Name | ADIPOQ |
Accession Number | BC096310 |
Gene ID | 9370 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 735 bp |
Gene Alias | ACRP30, adiponectin, APM-1, APM1, GBP28 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15572-Ab | Anti-ADIPO/ ADIPOQ/ ACDC functional antibody |
Target Antigen | GM-Tg-g-T15572-Ag | ADIPOQ protein |
ORF Viral Vector | pGMAP000564 | Human ADIPOQ Adenovirus plasmid |
ORF Viral Vector | vGMAP000564 | Human ADIPOQ Adenovirus particle |
ORF Viral Vector | pGMLV002165 | Human ADIPOQ Lentivirus plasmid |
Target information
Target ID | GM-T15572 |
Target Name | ADIPOQ |
Gene ID | 9370, 11450, 574212, 246253, 554338, 403625, 282865, 100059500 |
Gene Symbol and Synonyms | 30kDa,ACDC,ACRP30,Ad,Adid,adipo,ADIPOQ,ADIPQTL1,ADPN,APM-1,APM1,APN,GBP28 |
Uniprot Accession | Q15848 |
Uniprot Entry Name | ADIPO_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000181092 |
Target Classification | Not Available |
This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.