Human ADIPOQ/ACRP30/ adiponectin ORF/cDNA clone-Adenovirus plasmid (BC096310)

Pre-made Human ADIPOQ/ACRP30/ adiponectin adenoviral expression plasmid for ADIPOQ adenovirus packaging, ADIPOQ adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to ADIPOQ/ACRP30 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000564 Human ADIPOQ Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000564
Gene Name ADIPOQ
Accession Number BC096310
Gene ID 9370
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 735 bp
Gene Alias ACRP30, adiponectin, APM-1, APM1, GBP28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGATGGCACCCCTGGTGAGAAGGGTGAGAAAGGAGATCCAGGTCTTATTGGTCCTAAGGGAGACATCGGTGAAACCGGAGTACCCGGGGCTGAAGGTCCCCGAGGCTTTCCGGGAATCCAAGGCAGGAAAGGAGAACCTGGAGAAGGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGATTGGAGACTTACGTTACTATCCCCAACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15572-Ab Anti-ADIPO/ ADIPOQ/ ACDC functional antibody
    Target Antigen GM-Tg-g-T15572-Ag ADIPOQ protein
    ORF Viral Vector pGMAP000564 Human ADIPOQ Adenovirus plasmid
    ORF Viral Vector vGMAP000564 Human ADIPOQ Adenovirus particle
    ORF Viral Vector pGMLV002165 Human ADIPOQ Lentivirus plasmid


    Target information

    Target ID GM-T15572
    Target Name ADIPOQ
    Gene ID 9370, 11450, 574212, 246253, 554338, 403625, 282865, 100059500
    Gene Symbol and Synonyms 30kDa,ACDC,ACRP30,Ad,Adid,adipo,ADIPOQ,ADIPQTL1,ADPN,APM-1,APM1,APN,GBP28
    Uniprot Accession Q15848
    Uniprot Entry Name ADIPO_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Breast Cancer
    Gene Ensembl ENSG00000181092
    Target Classification Not Available

    This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.