Human CSF2/CSF/ GMCSF ORF/cDNA clone-Lentivirus particle (NM_000758)

Pre-made Human CSF2/CSF/ GMCSF Lentiviral expression plasmid for CSF2 lentivirus packaging, CSF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CSF2/CSF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000211 Human CSF2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000211
Gene Name CSF2
Accession Number NM_000758
Gene ID 1437
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 435 bp
Gene Alias CSF, GMCSF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCAGCACTGCCCTCCAACCCCGGAAACTTCCTGTGCAACCCAGATTATCACCTTTGAAAGTTTCAAAGAGAACCTGAAGGACTTTCTGCTTGTCATCCCCTTTGACTGCTGGGAGCCAGTCCAGGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-303 Pre-Made Lenzilumab biosimilar, Whole mAb, Anti-CSF2 Antibody: Anti-CSF/GMCSF therapeutic antibody
    Biosimilar GMP-Bios-ab-244 Pre-Made Gimsilumab biosimilar, Whole mAb, Anti-CSF2 Antibody: Anti-CSF/GMCSF therapeutic antibody
    Biosimilar GMP-Bios-ab-453 Pre-Made Plonmarlimab biosimilar, Whole mAb, Anti-CSF2 Antibody: Anti-CSF/GMCSF therapeutic antibody
    Biosimilar GMP-Bios-ab-362 Pre-Made Namilumab biosimilar, Whole mAb, Anti-CSF2 Antibody: Anti-CSF/GMCSF therapeutic antibody
    Biosimilar GMP-Bios-ab-415 Pre-Made Otilimab biosimilar, Whole mAb, Anti-CSF2 Antibody: Anti-CSF/GMCSF therapeutic antibody
    Target Antibody GM-Tg-g-T74002-Ab Anti-CSF2/ CSF/ GMCSF monoclonal antibody
    Target Antigen GM-Tg-g-T74002-Ag CSF2 VLP (virus-like particle)
    ORF Viral Vector pGMAAV000364 Human CSF2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP000211 Human CSF2 Lentivirus plasmid
    ORF Viral Vector vGMAAV000364 Human CSF2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP000211 Human CSF2 Lentivirus particle


    Target information

    Target ID GM-T74002
    Target Name CSF2
    Gene ID 1437, 12981, 574371, 116630, 101094153, 403923, 281095, 100033981
    Gene Symbol and Synonyms CSF,CSF2,Csfgm,Gm-CSf,GMCSF,MGI-IGM
    Uniprot Accession P04141
    Uniprot Entry Name CSF2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease metastatic tumors, Overactive bladder
    Gene Ensembl ENSG00000164400
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. This gene plays a role in promoting tissue inflammation. Elevated levels of cytokines, including the one produced by this gene, have been detected in SARS-CoV-2 infected patients that develop acute respiratory distress syndrome. Mice deficient in this gene or its receptor develop pulmonary alveolar proteinosis. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.