Human RNASEH1/H1RNA/ PEOB2 ORF/cDNA clone-Lentivirus particle (NM_002936)
Pre-made Human RNASEH1/H1RNA/ PEOB2 Lentiviral expression plasmid for RNASEH1 lentivirus packaging, RNASEH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RNASEH1/H1RNA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002657 | Human RNASEH1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002657 |
Gene Name | RNASEH1 |
Accession Number | NM_002936 |
Gene ID | 246243 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 861 bp |
Gene Alias | H1RNA, PEOB2, RNH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCTGGCTTCTGTTCCTGGCCCACAGAGTCGCCTTGGCCGCCTTGCCCTGCCGCCGCGGCTCTCGCGGGTTCGGGATGTTCTATGCCGTGAGGAGGGGCCGCAAGACCGGGGTCTTTCTGACCTGGAATGAGTGCAGAGCACAGGTGGACCGGTTTCCTGCTGCCAGATTTAAGAAGTTTGCCACAGAGGATGAGGCCTGGGCCTTTGTCAGGAAATCTGCAAGCCCGGAAGTTTCAGAAGGGCATGAAAATCAACATGGACAAGAATCGGAGGCGAAAGCCAGCAAGCGACTCCGTGAGCCACTGGATGGAGATGGACATGAAAGCGCAGAGCCGTATGCAAAGCACATGAAGCCGAGCGTGGAGCCGGCGCCTCCAGTTAGCAGAGACACGTTTTCCTACATGGGAGACTTCGTCGTCGTCTACACTGATGGCTGCTGCTCCAGTAATGGGCGTAGAAGGCCGCGAGCAGGAATCGGCGTTTACTGGGGGCCAGGCCATCCTTTAAATGTAGGCATTAGACTTCCTGGGCGGCAGACAAACCAAAGAGCGGAAATTCATGCAGCCTGCAAAGCCATTGAACAAGCAAAGACTCAAAACATCAATAAACTGGTTCTGTATACAGACAGTATGTTTACGATAAATGGTATAACTAACTGGGTTCAAGGTTGGAAGAAAAATGGGTGGAAGACAAGTGCAGGGAAAGAGGTGATCAACAAAGAGGACTTTGTGGCACTGGAGAGGCTTACCCAGGGGATGGACATTCAGTGGATGCATGTTCCTGGTCATTCGGGATTTATAGGCAATGAAGAAGCTGACAGATTAGCCAGAGAAGGAGCTAAACAATCGGAAGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1599-Ab | Anti-RNH1/ RNASEH1/ H1RNA functional antibody |
Target Antigen | GM-Tg-g-SE1599-Ag | RNASEH1 protein |
ORF Viral Vector | pGMLV002017 | Human RNASEH1 Lentivirus plasmid |
ORF Viral Vector | pGMLP002657 | Human RNASEH1 Lentivirus plasmid |
ORF Viral Vector | vGMLV002017 | Human RNASEH1 Lentivirus particle |
ORF Viral Vector | vGMLP002657 | Human RNASEH1 Lentivirus particle |
ORF Viral Vector | pGMLV002150 | Human RNASEH1 Lentivirus plasmid |
Target information
Target ID | GM-SE1599 |
Target Name | RNASEH1 |
Gene ID | 246243, 19819, 707122, 298933, 101097476, 475648, 613354, 100072832 |
Gene Symbol and Synonyms | H1RNA,PEOB2,RNASEH1,RNH1 |
Uniprot Accession | O60930 |
Uniprot Entry Name | RNH1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000171865 |
Target Classification | Not Available |
This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and plays a key role in DNA replication and repair. Alternate in-frame start codon initiation results in the production of alternate isoforms that are directed to the mitochondria or to the nucleus. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF). Mutations in this gene have been found in individuals with progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2. Alternative splicing results in additional coding and non-coding transcript variants. Pseudogenes of this gene have been defined on chromosomes 2 and 17. [provided by RefSeq, Jul 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.