Human RNASEH1/H1RNA/PEOB2 ORF/cDNA clone-Lentivirus particle (NM_002936)

Cat. No.: vGMLV002017

Pre-made Human RNASEH1/H1RNA/PEOB2 Lentiviral expression plasmid for RNASEH1 lentivirus packaging, RNASEH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RNASEH1/H1RNA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002017 Human RNASEH1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002017
Gene Name RNASEH1
Accession Number NM_002936
Gene ID 246243
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 861 bp
Gene Alias H1RNA,PEOB2,RNH1
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTGGCTTCTGTTCCTGGCCCACAGAGTCGCCTTGGCCGCCTTGCCCTGCCGCCGCGGCTCTCGCGGGTTCGGGATGTTCTATGCCGTGAGGAGGGGCCGCAAGACCGGGGTCTTTCTGACCTGGAATGAGTGCAGAGCACAGGTGGACCGGTTTCCTGCTGCCAGATTTAAGAAGTTTGCCACAGAGGATGAGGCCTGGGCCTTTGTCAGGAAATCTGCAAGCCCGGAAGTTTCAGAAGGGCATGAAAATCAACATGGACAAGAATCGGAGGCGAAAGCCAGCAAGCGACTCCGTGAGCCACTGGATGGAGATGGACATGAAAGCGCAGAGCCGTATGCAAAGCACATGAAGCCGAGCGTGGAGCCGGCGCCTCCAGTTAGCAGAGACACGTTTTCCTACATGGGAGACTTCGTCGTCGTCTACACTGATGGCTGCTGCTCCAGTAATGGGCGTAGAAGGCCGCGAGCAGGAATCGGCGTTTACTGGGGGCCAGGCCATCCTTTAAATGTAGGCATTAGACTTCCTGGGCGGCAGACAAACCAAAGAGCGGAAATTCATGCAGCCTGCAAAGCCATTGAACAAGCAAAGACTCAAAACATCAATAAACTGGTTCTGTATACAGACAGTATGTTTACGATAAATGGTATAACTAACTGGGTTCAAGGTTGGAAGAAAAATGGGTGGAAGACAAGTGCAGGGAAAGAGGTGATCAACAAAGAGGACTTTGTGGCACTGGAGAGGCTTACCCAGGGGATGGACATTCAGTGGATGCATGTTCCTGGTCATTCGGGATTTATAGGCAATGAAGAAGCTGACAGATTAGCCAGAGAAGGAGCTAAACAATCGGAAGACTGA
ORF Protein Sequence MSWLLFLAHRVALAALPCRRGSRGFGMFYAVRRGRKTGVFLTWNECRAQVDRFPAARFKKFATEDEAWAFVRKSASPEVSEGHENQHGQESEAKASKRLREPLDGDGHESAEPYAKHMKPSVEPAPPVSRDTFSYMGDFVVVYTDGCCSSNGRRRPRAGIGVYWGPGHPLNVGIRLPGRQTNQRAEIHAACKAIEQAKTQNINKLVLYTDSMFTINGITNWVQGWKKNGWKTSAGKEVINKEDFVALERLTQGMDIQWMHVPGHSGFIGNEEADRLAREGAKQSED

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1599-Ab Anti-RNH1/ RNASEH1/ H1RNA functional antibody
    Target Antigen GM-Tg-g-SE1599-Ag RNASEH1 protein
    ORF Viral Vector pGMLP002657 Human RNASEH1 Lentivirus plasmid
    ORF Viral Vector pGMLV002017 Human RNASEH1 Lentivirus plasmid
    ORF Viral Vector pGMLV002150 Human RNASEH1 Lentivirus plasmid
    ORF Viral Vector vGMLP002657 Human RNASEH1 Lentivirus particle
    ORF Viral Vector vGMLV002017 Human RNASEH1 Lentivirus particle
    ORF Viral Vector vGMLV002150 Human RNASEH1 Lentivirus particle


    Target information

    Target ID GM-SE1599
    Target Name RNASEH1
    Gene ID 246243, 19819, 707122, 298933, 101097476, 475648, 613354, 100072832
    Gene Symbol and Synonyms H1RNA,PEOB2,RNASEH1,RNH1
    Uniprot Accession O60930
    Uniprot Entry Name RNH1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000171865
    Target Classification Not Available

    This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and plays a key role in DNA replication and repair. Alternate in-frame start codon initiation results in the production of alternate isoforms that are directed to the mitochondria or to the nucleus. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF). Mutations in this gene have been found in individuals with progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2. Alternative splicing results in additional coding and non-coding transcript variants. Pseudogenes of this gene have been defined on chromosomes 2 and 17. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.