Human MTNR1A/MEL-1A-R/ MT1 ORF/cDNA clone-Lentivirus particle (NM_005958)

Pre-made Human MTNR1A/MEL-1A-R/ MT1 Lentiviral expression plasmid for MTNR1A lentivirus packaging, MTNR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MTNR1A/MEL-1A-R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003856 Human MTNR1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003856
Gene Name MTNR1A
Accession Number NM_005958
Gene ID 4543
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1053 bp
Gene Alias MEL-1A-R, MT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGGCAACGGCAGCGCGCTGCCCAACGCCTCCCAGCCCGTGCTCCGCGGGGACGGCGCGCGGCCCTCGTGGCTGGCGTCCGCCCTGGCCTGCGTCCTCATCTTCACCATCGTGGTGGACATCCTGGGCAACCTCCTGGTCATCCTGTCGGTGTATCGGAACAAGAAGCTCAGGAACGCAGGAAACATCTTTGTGGTGAGCTTAGCGGTGGCAGACCTGGTGGTGGCCATTTATCCGTACCCGTTGGTGCTGATGTCGATATTTAACAACGGGTGGAACCTGGGCTATCTGCACTGCCAAGTCAGTGGGTTCCTGATGGGCCTGAGCGTCATCGGCTCCATATTCAACATCACCGGCATCGCCATCAACCGCTACTGCTACATCTGCCACAGTCTCAAGTACGACAAACTGTACAGCAGCAAGAACTCCCTCTGCTACGTGCTCCTCATATGGCTCCTGACGCTGGCGGCCGTCCTGCCCAACCTCCGTGCAGGGACTCTCCAGTACGACCCGAGGATCTACTCGTGCACCTTCGCCCAGTCCGTCAGCTCCGCCTACACCATCGCCGTGGTGGTTTTCCACTTCCTCGTCCCCATGATCATAGTCATCTTCTGTTACCTGAGAATATGGATCCTGGTTCTCCAGGTCAGACAGAGGGTGAAACCTGACCGCAAACCCAAACTGAAACCACAGGACTTCAGGAATTTTGTCACCATGTTTGTGGTTTTTGTCCTTTTTGCCATTTGCTGGGCTCCTCTGAACTTCATTGGCCTGGCCGTGGCCTCTGACCCCGCCAGCATGGTGCCTAGGATCCCAGAGTGGCTGTTTGTGGCCAGTTACTACATGGCGTATTTCAACAGCTGCCTCAATGCCATTATATACGGGCTACTGAACCAAAATTTCAGGAAGGAATACAGGAGAATTATAGTCTCGCTCTGTACAGCCAGGGTGTTCTTTGTGGACAGCTCTAACGACGTGGCCGATAGGGTTAAATGGAAACCGTCTCCACTGATGACCAACAATAATGTAGTAAAGGTGGACTCCGTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97613-Ab Anti-MTR1A/ MTNR1A/ MEL-1A-R monoclonal antibody
    Target Antigen GM-Tg-g-T97613-Ag MTNR1A VLP (virus-like particle)
    ORF Viral Vector pGMLP003856 Human MTNR1A Lentivirus plasmid
    ORF Viral Vector vGMLP003856 Human MTNR1A Lentivirus particle


    Target information

    Target ID GM-T97613
    Target Name MTNR1A
    Gene ID 4543, 17773, 702686, 114211, 101098297, 482904, 539948, 100056423
    Gene Symbol and Synonyms MEL-1A-R,MelR,MR,MT1,MTNR1A
    Uniprot Accession P48039
    Uniprot Entry Name MTR1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000168412
    Target Classification GPCR

    This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.