Human MTNR1A/MEL-1A-R/ MT1 ORF/cDNA clone-Lentivirus particle (NM_005958)
Pre-made Human MTNR1A/MEL-1A-R/ MT1 Lentiviral expression plasmid for MTNR1A lentivirus packaging, MTNR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to MTNR1A/MEL-1A-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003856 | Human MTNR1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003856 |
Gene Name | MTNR1A |
Accession Number | NM_005958 |
Gene ID | 4543 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1053 bp |
Gene Alias | MEL-1A-R, MT1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGGGCAACGGCAGCGCGCTGCCCAACGCCTCCCAGCCCGTGCTCCGCGGGGACGGCGCGCGGCCCTCGTGGCTGGCGTCCGCCCTGGCCTGCGTCCTCATCTTCACCATCGTGGTGGACATCCTGGGCAACCTCCTGGTCATCCTGTCGGTGTATCGGAACAAGAAGCTCAGGAACGCAGGAAACATCTTTGTGGTGAGCTTAGCGGTGGCAGACCTGGTGGTGGCCATTTATCCGTACCCGTTGGTGCTGATGTCGATATTTAACAACGGGTGGAACCTGGGCTATCTGCACTGCCAAGTCAGTGGGTTCCTGATGGGCCTGAGCGTCATCGGCTCCATATTCAACATCACCGGCATCGCCATCAACCGCTACTGCTACATCTGCCACAGTCTCAAGTACGACAAACTGTACAGCAGCAAGAACTCCCTCTGCTACGTGCTCCTCATATGGCTCCTGACGCTGGCGGCCGTCCTGCCCAACCTCCGTGCAGGGACTCTCCAGTACGACCCGAGGATCTACTCGTGCACCTTCGCCCAGTCCGTCAGCTCCGCCTACACCATCGCCGTGGTGGTTTTCCACTTCCTCGTCCCCATGATCATAGTCATCTTCTGTTACCTGAGAATATGGATCCTGGTTCTCCAGGTCAGACAGAGGGTGAAACCTGACCGCAAACCCAAACTGAAACCACAGGACTTCAGGAATTTTGTCACCATGTTTGTGGTTTTTGTCCTTTTTGCCATTTGCTGGGCTCCTCTGAACTTCATTGGCCTGGCCGTGGCCTCTGACCCCGCCAGCATGGTGCCTAGGATCCCAGAGTGGCTGTTTGTGGCCAGTTACTACATGGCGTATTTCAACAGCTGCCTCAATGCCATTATATACGGGCTACTGAACCAAAATTTCAGGAAGGAATACAGGAGAATTATAGTCTCGCTCTGTACAGCCAGGGTGTTCTTTGTGGACAGCTCTAACGACGTGGCCGATAGGGTTAAATGGAAACCGTCTCCACTGATGACCAACAATAATGTAGTAAAGGTGGACTCCGTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T97613-Ab | Anti-MTR1A/ MTNR1A/ MEL-1A-R monoclonal antibody |
Target Antigen | GM-Tg-g-T97613-Ag | MTNR1A VLP (virus-like particle) |
ORF Viral Vector | pGMLP003856 | Human MTNR1A Lentivirus plasmid |
ORF Viral Vector | vGMLP003856 | Human MTNR1A Lentivirus particle |
Target information
Target ID | GM-T97613 |
Target Name | MTNR1A |
Gene ID | 4543, 17773, 702686, 114211, 101098297, 482904, 539948, 100056423 |
Gene Symbol and Synonyms | MEL-1A-R,MelR,MR,MT1,MTNR1A |
Uniprot Accession | P48039 |
Uniprot Entry Name | MTR1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000168412 |
Target Classification | GPCR |
This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.