Human PTGDS/L-PGDS/LPGDS ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_000954)
Cat. No.: pGMAAV001623
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PTGDS/L-PGDS/LPGDS Adeno-associated virus expression plasmid (ITR-vector) for PTGDS AAV packaging, PTGDS AAV production.The purified Human PTGDS/L-PGDS/LPGDS AAV particle serves as an invaluable asset for in-depth in vivo PTGDS studies, mechanism of action (MOA) research, and the evolution of PTGDS-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go to
PTGDS/L-PGDS products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAAV001623 |
Gene Name | PTGDS |
Accession Number | NM_000954 |
Gene ID | 5730 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 573 bp |
Gene Alias | L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CTNT |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTACTCATCACACACTGTGGATGGGACTGGCCCTGCTGGGGGTGCTGGGCGACCTGCAGGCAGCACCGGAGGCCCAGGTCTCCGTGCAGCCCAACTTCCAGCAGGACAAGTTCCTGGGGCGCTGGTTCAGCGCGGGCCTCGCCTCCAACTCGAGCTGGCTCCGGGAGAAGAAGGCGGCGTTGTCCATGTGCAAGTCTGTGGTGGCCCCTGCCACGGATGGTGGCCTCAACCTGACCTCCACCTTCCTCAGGAAAAACCAGTGTGAGACCCGAACCATGCTGCTGCAGCCCGCGGGGTCCCTCGGCTCCTACAGCTACCGGAGTCCCCACTGGGGCAGCACCTACTCCGTGTCAGTGGTGGAGACCGACTACGACCAGTACGCGCTGCTGTACAGCCAGGGCAGCAAGGGCCCTGGCGAGGACTTCCGCATGGCCACCCTCTACAGCCGAACCCAGACCCCCAGGGCTGAGTTAAAGGAGAAATTCACCGCCTTCTGCAAGGCCCAGGGCTTCACAGAGGATACCATTGTCTTCCTGCCCCAAACCGATAAGTGCATGACGGAACAATAG |
ORF Protein Sequence | MATHHTLWMGLALLGVLGDLQAAPEAQVSVQPNFQQDKFLGRWFSAGLASNSSWLREKKAALSMCKSVVAPATDGGLNLTSTFLRKNQCETRTMLLQPAGSLGSYSYRSPHWGSTYSVSVVETDYDQYALLYSQGSKGPGEDFRMATLYSRTQTPRAELKEKFTAFCKAQGFTEDTIVFLPQTDKCMTEQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1229-Ab | Anti-PTGDS/ L-PGDS/ LPGDS functional antibody |
Target Antigen | GM-Tg-g-SE1229-Ag | PTGDS protein |
ORF Viral Vector | pGMLP002273 | Human PTGDS Lentivirus plasmid |
ORF Viral Vector | pGMAAV001623 | Human PTGDS Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLP002273 | Human PTGDS Lentivirus particle |
ORF Viral Vector | vGMAAV001623 | Human PTGDS Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-SE1229 |
Target Name | PTGDS |
Gene ID | 5730, 19215, 707990, 25526, 493852, 403740, 286858, 100067921 |
Gene Symbol and Synonyms | 21kDa,L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2,PH2DISO,PTGDS,Ptgs3 |
Uniprot Accession | P41222 |
Uniprot Entry Name | PTGDS_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Drug-Induced Nephropathy, Contrast - Induced Nephropathy, Diabetic Nephropathy, Lupus Glomerulonephritis |
Gene Ensembl | ENSG00000107317 |
Target Classification | Not Available |
The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.