Human PTGDS/L-PGDS/ LPGDS ORF/cDNA clone-Lentivirus plasmid (NM_000954)
Pre-made Human PTGDS/L-PGDS/ LPGDS Lentiviral expression plasmid for PTGDS lentivirus packaging, PTGDS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PTGDS/L-PGDS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002273 | Human PTGDS Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002273 |
Gene Name | PTGDS |
Accession Number | NM_000954 |
Gene ID | 5730 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 573 bp |
Gene Alias | L-PGDS, LPGDS, PDS, PGD2, PGDS, PGDS2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTACTCATCACACGCTGTGGATGGGACTGGCCCTGCTGGGGGTGCTGGGCGACCTGCAGGCAGCACCGGAGGCCCAGGTCTCCGTGCAGCCCAACTTCCAGCAGGACAAGTTCCTGGGGCGCTGGTTCAGCGCGGGCCTCGCCTCCAACTCGAGCTGGCTCCGGGAGAAGAAGGCGGCGTTGTCCATGTGCAAGTCTGTGGTGGCCCCTGCCACGGATGGTGGCCTCAACCTGACCTCCACCTTCCTCAGGAAAAACCAGTGTGAGACCCGAACCATGCTGCTGCAGCCCGCGGGGTCCCTCGGCTCCTACAGCTACCGGAGTCCCCACTGGGGCAGCACCTACTCCGTGTCAGTGGTGGAGACCGACTACGACCAGTACGCGCTGCTGTACAGCCAGGGCAGCAAGGGCCCTGGCGAGGACTTCCGCATGGCCACCCTCTACAGCCGAACCCAGACCCCCAGGGCTGAGTTAAAGGAGAAATTCACCGCCTTCTGCAAGGCCCAGGGCTTCACAGAGGATACCATTGTCTTCCTGCCCCAAACCGATAAGTGCATGACGGAACAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1229-Ab | Anti-PTGDS/ L-PGDS/ LPGDS functional antibody |
Target Antigen | GM-Tg-g-SE1229-Ag | PTGDS protein |
ORF Viral Vector | pGMLP002273 | Human PTGDS Lentivirus plasmid |
ORF Viral Vector | vGMLP002273 | Human PTGDS Lentivirus particle |
Target information
Target ID | GM-SE1229 |
Target Name | PTGDS |
Gene ID | 5730, 19215, 707990, 25526, 493852, 403740, 286858, 100067921 |
Gene Symbol and Synonyms | 21kDa,L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2,PH2DISO,PTGDS,Ptgs3 |
Uniprot Accession | P41222 |
Uniprot Entry Name | PTGDS_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Drug-Induced Nephropathy, Contrast - Induced Nephropathy, Diabetic Nephropathy, Lupus Glomerulonephritis |
Gene Ensembl | ENSG00000107317 |
Target Classification | Not Available |
The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.