Human PTGDS/L-PGDS/ LPGDS ORF/cDNA clone-Lentivirus plasmid (NM_000954)

Pre-made Human PTGDS/L-PGDS/ LPGDS Lentiviral expression plasmid for PTGDS lentivirus packaging, PTGDS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PTGDS/L-PGDS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002273 Human PTGDS Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002273
Gene Name PTGDS
Accession Number NM_000954
Gene ID 5730
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 573 bp
Gene Alias L-PGDS, LPGDS, PDS, PGD2, PGDS, PGDS2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTACTCATCACACGCTGTGGATGGGACTGGCCCTGCTGGGGGTGCTGGGCGACCTGCAGGCAGCACCGGAGGCCCAGGTCTCCGTGCAGCCCAACTTCCAGCAGGACAAGTTCCTGGGGCGCTGGTTCAGCGCGGGCCTCGCCTCCAACTCGAGCTGGCTCCGGGAGAAGAAGGCGGCGTTGTCCATGTGCAAGTCTGTGGTGGCCCCTGCCACGGATGGTGGCCTCAACCTGACCTCCACCTTCCTCAGGAAAAACCAGTGTGAGACCCGAACCATGCTGCTGCAGCCCGCGGGGTCCCTCGGCTCCTACAGCTACCGGAGTCCCCACTGGGGCAGCACCTACTCCGTGTCAGTGGTGGAGACCGACTACGACCAGTACGCGCTGCTGTACAGCCAGGGCAGCAAGGGCCCTGGCGAGGACTTCCGCATGGCCACCCTCTACAGCCGAACCCAGACCCCCAGGGCTGAGTTAAAGGAGAAATTCACCGCCTTCTGCAAGGCCCAGGGCTTCACAGAGGATACCATTGTCTTCCTGCCCCAAACCGATAAGTGCATGACGGAACAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1229-Ab Anti-PTGDS/ L-PGDS/ LPGDS functional antibody
    Target Antigen GM-Tg-g-SE1229-Ag PTGDS protein
    ORF Viral Vector pGMLP002273 Human PTGDS Lentivirus plasmid
    ORF Viral Vector vGMLP002273 Human PTGDS Lentivirus particle


    Target information

    Target ID GM-SE1229
    Target Name PTGDS
    Gene ID 5730, 19215, 707990, 25526, 493852, 403740, 286858, 100067921
    Gene Symbol and Synonyms 21kDa,L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2,PH2DISO,PTGDS,Ptgs3
    Uniprot Accession P41222
    Uniprot Entry Name PTGDS_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Drug-Induced Nephropathy, Contrast - Induced Nephropathy, Diabetic Nephropathy, Lupus Glomerulonephritis
    Gene Ensembl ENSG00000107317
    Target Classification Not Available

    The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.