Human PTGDS/L-PGDS/LPGDS ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_000954)

Cat. No.: vGMAAV001623

Pre-made Human PTGDS/L-PGDS/LPGDS Adeno-associated virus particle for PTGDS in-vivo study, mechanism of action (MOA) research and PTGDS-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to PTGDS/L-PGDS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV001623 Human PTGDS Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV001623
Gene Name PTGDS
Accession Number NM_000954
Gene ID 5730
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 573 bp
Gene Alias L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CTNT
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTACTCATCACACACTGTGGATGGGACTGGCCCTGCTGGGGGTGCTGGGCGACCTGCAGGCAGCACCGGAGGCCCAGGTCTCCGTGCAGCCCAACTTCCAGCAGGACAAGTTCCTGGGGCGCTGGTTCAGCGCGGGCCTCGCCTCCAACTCGAGCTGGCTCCGGGAGAAGAAGGCGGCGTTGTCCATGTGCAAGTCTGTGGTGGCCCCTGCCACGGATGGTGGCCTCAACCTGACCTCCACCTTCCTCAGGAAAAACCAGTGTGAGACCCGAACCATGCTGCTGCAGCCCGCGGGGTCCCTCGGCTCCTACAGCTACCGGAGTCCCCACTGGGGCAGCACCTACTCCGTGTCAGTGGTGGAGACCGACTACGACCAGTACGCGCTGCTGTACAGCCAGGGCAGCAAGGGCCCTGGCGAGGACTTCCGCATGGCCACCCTCTACAGCCGAACCCAGACCCCCAGGGCTGAGTTAAAGGAGAAATTCACCGCCTTCTGCAAGGCCCAGGGCTTCACAGAGGATACCATTGTCTTCCTGCCCCAAACCGATAAGTGCATGACGGAACAATAG
ORF Protein Sequence MATHHTLWMGLALLGVLGDLQAAPEAQVSVQPNFQQDKFLGRWFSAGLASNSSWLREKKAALSMCKSVVAPATDGGLNLTSTFLRKNQCETRTMLLQPAGSLGSYSYRSPHWGSTYSVSVVETDYDQYALLYSQGSKGPGEDFRMATLYSRTQTPRAELKEKFTAFCKAQGFTEDTIVFLPQTDKCMTEQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1229-Ab Anti-PTGDS/ L-PGDS/ LPGDS functional antibody
    Target Antigen GM-Tg-g-SE1229-Ag PTGDS protein
    ORF Viral Vector pGMLP002273 Human PTGDS Lentivirus plasmid
    ORF Viral Vector pGMAAV001623 Human PTGDS Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP002273 Human PTGDS Lentivirus particle
    ORF Viral Vector vGMAAV001623 Human PTGDS Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1229
    Target Name PTGDS
    Gene ID 5730, 19215, 707990, 25526, 493852, 403740, 286858, 100067921
    Gene Symbol and Synonyms 21kDa,L-PGDS,LPGDS,PDS,PGD2,PGDS,PGDS2,PH2DISO,PTGDS,Ptgs3
    Uniprot Accession P41222
    Uniprot Entry Name PTGDS_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Drug-Induced Nephropathy, Contrast - Induced Nephropathy, Diabetic Nephropathy, Lupus Glomerulonephritis
    Gene Ensembl ENSG00000107317
    Target Classification Not Available

    The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.