Human NTF3/HDNF/NGF-2 ORF/cDNA clone-Adenovirus plasmid (NM_001102654)

Cat. No.: pGMAD000046
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NTF3/HDNF/NGF-2 adenoviral expression plasmid for NTF3 adenovirus packaging, NTF3 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to NTF3/HDNF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000046
Gene Name NTF3
Accession Number NM_001102654
Gene ID 4908
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 813 bp
Gene Alias HDNF,NGF-2,NGF2,NT-3,NT3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTACTTTTGCCACGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATAAACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAAAAATCGGAAGAACATGA
ORF Protein Sequence MVTFATILQVNKVMSILFYVIFLAYLRGIQGNNMDQRSLPEDSLNSLIIKLIQADILKNKLSKQMVDVKENYQSTLPKAEAPREPERGGPAKSAFQPVIAMDTELLRQQRRYNSPRVLLSDSTPLEPPPLYLMEDYVGSPVVANRTSRRKRYAEHKSHRGEYSVCDSESLWVTDKSSAIDIRGHQVTVLGEIKTGNSPVKQYFYETRCKEARPVKNGCRGIDDKHWNSQCKTSQTYVRALTSENNKLVGWRWIRIDTSCVCALSRKIGRT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32855-Ab Anti-NTF3/ HDNF/ NGF-2 functional antibody
    Target Antigen GM-Tg-g-T32855-Ag NTF3 protein
    ORF Viral Vector pGMLV002188 Human NTF3 Lentivirus plasmid
    ORF Viral Vector pGMAD000046 Human NTF3 Adenovirus plasmid
    ORF Viral Vector pGMAP000383 Human NTF3 Adenovirus plasmid
    ORF Viral Vector vGMLV002188 Human NTF3 Lentivirus particle
    ORF Viral Vector vGMAD000046 Human NTF3 Adenovirus particle
    ORF Viral Vector vGMAP000383 Human NTF3 Adenovirus particle


    Target information

    Target ID GM-T32855
    Target Name NTF3
    Gene ID 4908, 18205, 721988, 81737, 493963, 486731, 532393, 100051839
    Gene Symbol and Synonyms HDNF,NGF-2,NGF2,NT-3,NT3,Ntf-3,NTF3
    Uniprot Accession P20783
    Uniprot Entry Name NTF3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Schizophrenia
    Gene Ensembl ENSG00000185652
    Target Classification Not Available

    The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.