Human NTF3/HDNF/ NGF-2 ORF/cDNA clone-Adenovirus plasmid (BC069773)
Pre-made Human NTF3/HDNF/ NGF-2 adenoviral expression plasmid for NTF3 adenovirus packaging, NTF3 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to NTF3/HDNF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000383 | Human NTF3 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000383 |
Gene Name | NTF3 |
Accession Number | BC069773 |
Gene ID | 4908 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 774 bp |
Gene Alias | HDNF, NGF-2, NGF2, NT3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATAAACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAAAAATCGGAAGAACATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T32855-Ab | Anti-NTF3/ HDNF/ NGF-2 functional antibody |
Target Antigen | GM-Tg-g-T32855-Ag | NTF3 protein |
ORF Viral Vector | pGMAD000046 | Human NTF3 Adenovirus plasmid |
ORF Viral Vector | pGMAP000383 | Human NTF3 Adenovirus plasmid |
ORF Viral Vector | pGMLPm001258 | Rat Ntf3 Lentivirus plasmid |
ORF Viral Vector | vGMAD000046 | Human NTF3 Adenovirus particle |
ORF Viral Vector | vGMAP000383 | Human NTF3 Adenovirus particle |
ORF Viral Vector | vGMLPm001258 | Rat Ntf3 Lentivirus particle |
ORF Viral Vector | pGMLV002188 | Human NTF3 Lentivirus plasmid |
Target information
Target ID | GM-T32855 |
Target Name | NTF3 |
Gene ID | 4908, 18205, 721988, 81737, 493963, 486731, 532393, 100051839 |
Gene Symbol and Synonyms | HDNF,NGF-2,NGF2,NT-3,NT3,Ntf-3,NTF3 |
Uniprot Accession | P20783 |
Uniprot Entry Name | NTF3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Schizophrenia |
Gene Ensembl | ENSG00000185652 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.