Human MDK/MK ORF/cDNA clone-Adenovirus plasmid (BC011704)

Pre-made Human MDK/MK adenoviral expression plasmid for MDK adenovirus packaging, MDK adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to Midkine/MDK/MK products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000446 Human MDK Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000446
Gene Name MDK
Accession Number BC011704
Gene ID 4192
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 432 bp
Gene Alias MK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCACCGAGGCTTCCTCCTCCTCACCCTCCTCGCCCTGCTGGCGCTCACCTCCGCGGTCGCCAAAAAGAAAGATAAGGTGAAGAAGGGCGGCCCGGGGAGCGAGTGCGCTGAGTGGGCCTGGGGGCCCTGCACCCCCAGCAGCAAGGATTGCGGCGTGGGTTTCCGCGAGGGCACCTGCGGGGCCCAGACCCAGCGCATCCGGTGCAGGGTGCCCTGCAACTGGAAGAAGGAGTTTGGAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCGTGTGATGGGGGCACAGGCACCAAAGTCCGCCAAGGCACCCTGAAGAAGGCGCGCTACAATGCTCAGTGCCAGGAGACCATCCGCGTCACCAAGCCCTGCACCCCCAAGACCAAAGCAAAGGCCAAAGCCAAGAAAGGGAAGGGAAAGGACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T03878-Ab Anti-MK/ Midkine/ MDK functional antibody
    Target Antigen GM-Tg-g-T03878-Ag Midkine/MDK protein
    ORF Viral Vector pGMLP000499 Human MDK Lentivirus plasmid
    ORF Viral Vector pGMAP000446 Human MDK Adenovirus plasmid
    ORF Viral Vector pGMAP000465 Human MDK Adenovirus plasmid
    ORF Viral Vector vGMLP000499 Human MDK Lentivirus particle
    ORF Viral Vector vGMAP000446 Human MDK Adenovirus particle
    ORF Viral Vector vGMAP000465 Human MDK Adenovirus particle


    Target information

    Target ID GM-T03878
    Target Name Midkine
    Gene ID 4192, 17242, 714591, 81517, 101087941, 119864230, 280852, 100147284
    Gene Symbol and Synonyms ARAP,MDK,Mek,MK,NEGF2
    Uniprot Accession P21741
    Uniprot Entry Name MK_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Lung Cancer, Malignant neoplasm of bladder, Urinary bladder urothelial carcinoma, breast cancer
    Gene Ensembl ENSG00000110492
    Target Classification Not Available

    This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.