Human MDK/ARAP/ MK ORF/cDNA clone-Lentivirus particle (NM_002391)
Pre-made Human MDK/ARAP/ MK Lentiviral expression plasmid for MDK lentivirus packaging, MDK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to Midkine/MDK/ARAP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000499 | Human MDK Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000499 |
Gene Name | MDK |
Accession Number | NM_002391 |
Gene ID | 4192 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 432 bp |
Gene Alias | ARAP, MK, NEGF2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCACCGAGGCTTCCTCCTCCTCACCCTCCTCGCCCTGCTGGCGCTCACCTCCGCGGTCGCCAAAAAGAAAGATAAGGTGAAGAAGGGCGGCCCGGGGAGCGAGTGCGCTGAGTGGGCCTGGGGGCCCTGCACCCCCAGCAGCAAGGATTGCGGCGTGGGTTTCCGCGAGGGCACCTGCGGGGCCCAGACCCAGCGCATCCGGTGCAGGGTGCCCTGCAACTGGAAGAAGGAGTTTGGAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCGTGTGATGGGGGCACAGGCACCAAAGTCCGCCAAGGCACCCTGAAGAAGGCGCGCTACAATGCTCAGTGCCAGGAGACCATCCGCGTCACCAAGCCCTGCACCCCCAAGACCAAAGCAAAGGCCAAAGCCAAGAAAGGGAAGGGAAAGGACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T03878-Ab | Anti-MK/ Midkine/ MDK functional antibody |
Target Antigen | GM-Tg-g-T03878-Ag | Midkine/MDK protein |
ORF Viral Vector | pGMLP000499 | Human MDK Lentivirus plasmid |
ORF Viral Vector | pGMAP000446 | Human MDK Adenovirus plasmid |
ORF Viral Vector | pGMAP000465 | Human MDK Adenovirus plasmid |
ORF Viral Vector | vGMLP000499 | Human MDK Lentivirus particle |
ORF Viral Vector | vGMAP000446 | Human MDK Adenovirus particle |
ORF Viral Vector | vGMAP000465 | Human MDK Adenovirus particle |
Target information
Target ID | GM-T03878 |
Target Name | Midkine |
Gene ID | 4192, 17242, 714591, 81517, 101087941, 119864230, 280852, 100147284 |
Gene Symbol and Synonyms | ARAP,MDK,Mek,MK,NEGF2 |
Uniprot Accession | P21741 |
Uniprot Entry Name | MK_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Lung Cancer, Malignant neoplasm of bladder, Urinary bladder urothelial carcinoma, breast cancer |
Gene Ensembl | ENSG00000110492 |
Target Classification | Not Available |
This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.