Human IL12A/CLMF/ IL-12A ORF/cDNA clone-Lentivirus plasmid (NM_000882)
Pre-made Human IL12A/CLMF/ IL-12A Lentiviral expression plasmid for IL12A lentivirus packaging, IL12A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL12A/CLMF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP-IL-015 | Human IL12A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP-IL-015 |
Gene Name | IL12A |
Accession Number | NM_000882 |
Gene ID | 3592 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 762 bp |
Gene Alias | CLMF, IL-12A, NFSK, NKSF1, P35 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGCCCCCTGGGTCAGCCTCCCAGCCACCGCCCTCACCTGCCGCGGCCACAGGTCTGCATCCAGCGGCTCGCCCTGTGTCCCTGCAGTGCCGGCTCAGCATGTGTCCAGCGCGCAGCCTCCTCCTTGTGGCTACCCTGGTCCTCCTGGACCACCTCAGTTTGGCCAGAAACCTCCCCGTGGCCACTCCAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13251-Ab | Anti-IL12A/ CLMF/ IL-12A functional antibody |
Target Antigen | GM-Tg-g-T13251-Ag | IL12A protein |
Cytokine | cks-Tg-g-GM-T13251 | IL-12 p70 (IL12A) protein & antibody |
ORF Viral Vector | pGMLV000443 | Human IL12A Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-015 | Human IL12A Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-098 | Human IL12A Adenovirus plasmid |
ORF Viral Vector | vGMLV000443 | Human IL12A Lentivirus particle |
ORF Viral Vector | vGMLP-IL-015 | Human IL12A Lentivirus particle |
ORF Viral Vector | vGMAP-IL-098 | Human IL12A Adenovirus particle |
Target information
Target ID | GM-T13251 |
Target Name | IL12A |
Gene ID | 3592, 16159, 703205, 84405, 493741, 403977, 281856, 100034215 |
Gene Symbol and Synonyms | CLMF,CLMF p35,Il-12 p35,IL-12A,IL-12p35,IL12A,IL12p35,Ll12a,NFSK,NKSF1,P35 |
Uniprot Accession | P29459 |
Uniprot Entry Name | IL12A_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | malignant glioma |
Gene Ensembl | ENSG00000168811 |
Target Classification | Not Available |
This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.