Human IL12A/CLMF/ IL-12A ORF/cDNA clone-Lentivirus particle (NM_000882)

Pre-made Human IL12A/CLMF/ IL-12A Lentiviral expression plasmid for IL12A lentivirus packaging, IL12A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL12A/CLMF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-IL-015 Human IL12A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-IL-015
Gene Name IL12A
Accession Number NM_000882
Gene ID 3592
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 762 bp
Gene Alias CLMF, IL-12A, NFSK, NKSF1, P35
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGCCCCCTGGGTCAGCCTCCCAGCCACCGCCCTCACCTGCCGCGGCCACAGGTCTGCATCCAGCGGCTCGCCCTGTGTCCCTGCAGTGCCGGCTCAGCATGTGTCCAGCGCGCAGCCTCCTCCTTGTGGCTACCCTGGTCCTCCTGGACCACCTCAGTTTGGCCAGAAACCTCCCCGTGGCCACTCCAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13251-Ab Anti-IL12A/ CLMF/ IL-12A functional antibody
    Target Antigen GM-Tg-g-T13251-Ag IL12A protein
    Cytokine cks-Tg-g-GM-T13251 IL-12 p70 (IL12A) protein & antibody
    ORF Viral Vector pGMLV000443 Human IL12A Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-015 Human IL12A Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-098 Human IL12A Adenovirus plasmid
    ORF Viral Vector vGMLV000443 Human IL12A Lentivirus particle
    ORF Viral Vector vGMLP-IL-015 Human IL12A Lentivirus particle
    ORF Viral Vector vGMAP-IL-098 Human IL12A Adenovirus particle


    Target information

    Target ID GM-T13251
    Target Name IL12A
    Gene ID 3592, 16159, 703205, 84405, 493741, 403977, 281856, 100034215
    Gene Symbol and Synonyms CLMF,CLMF p35,Il-12 p35,IL-12A,IL-12p35,IL12A,IL12p35,Ll12a,NFSK,NKSF1,P35
    Uniprot Accession P29459
    Uniprot Entry Name IL12A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease malignant glioma
    Gene Ensembl ENSG00000168811
    Target Classification Not Available

    This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.