Human FIS1/CGI-135/ TTC11 ORF/cDNA clone-Lentivirus plasmid (NM_016068)
Pre-made Human FIS1/CGI-135/ TTC11 Lentiviral expression plasmid for FIS1 lentivirus packaging, FIS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to FIS1/CGI-135 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP-SPh-093 | Human FIS1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP-SPh-093 |
Gene Name | FIS1 |
Accession Number | NM_016068 |
Gene ID | 51024 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 459 bp |
Gene Alias | CGI-135, TTC11 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGACCTGCTGAAGTTTGAAAAGAAATTTCAGTCTGAGAAGGCAGCAGGCTCGGTGTCCAAGAGCACGCAGTTTGAGTACGCCTGGTGCCTGGTGCGGAGCAAGTACAATGATGACATCCGTAAAGGCATCGTGCTGCTCGAGGAGCTGCTGCCCAAAGGGAGCAAGGAGGAACAGCGGGATTACGTCTTCTACCTGGCCGTGGGGAACTACCGGCTCAAGGAATACGAGAAGGCCTTAAAGTACGTCCGCGGGTTGCTGCAGACAGAGCCCCAGAACAACCAGGCCAAGGAACTGGAGCGGCTCATTGACAAGGCCATGAAGAAAGATGGACTCGTGGGCATGGCCATCGTGGGAGGCATGGCCCTGGGTGTGGCGGGACTGGCCGGACTCATCGGACTTGCTGTGTCCAAGTCCAAATCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0847-Ab | Anti-FIS1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0847-Ag | FIS1 protein |
ORF Viral Vector | pGMAD000048 | Rat Fis1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000275 | Human FIS1 Adenovirus plasmid |
ORF Viral Vector | pGMLP002675 | Human FIS1 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-093 | Human FIS1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-233 | Human FIS1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000048 | Rat Fis1 Adenovirus particle |
ORF Viral Vector | vGMAD000275 | Human FIS1 Adenovirus particle |
ORF Viral Vector | vGMLP002675 | Human FIS1 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-093 | Human FIS1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-233 | Human FIS1 Adenovirus particle |
Target information
Target ID | GM-IP0847 |
Target Name | FIS1 |
Gene ID | 51024, 66437, 714444, 288584, 101081944, 479728, 615565, 100059592 |
Gene Symbol and Synonyms | 2010003O14Rik,CGI-135,FIS1,TTC11 |
Uniprot Accession | Q9Y3D6 |
Uniprot Entry Name | FIS1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000214253 |
Target Classification | Not Available |
The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.