Human FIS1/CGI-135/ TTC11 ORF/cDNA clone-Lentivirus particle (NM_016068)

Pre-made Human FIS1/CGI-135/ TTC11 Lentiviral expression plasmid for FIS1 lentivirus packaging, FIS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FIS1/CGI-135 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002675 Human FIS1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002675
Gene Name FIS1
Accession Number NM_016068
Gene ID 51024
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 459 bp
Gene Alias CGI-135, TTC11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGACCTGCTGAAGTTTGAAAAGAAATTTCAGTCTGAGAAGGCAGCAGGCTCGGTGTCCAAGAGCACGCAGTTTGAGTACGCCTGGTGCCTGGTGCGGAGCAAGTACAATGATGACATCCGTAAAGGCATCGTGCTGCTCGAGGAGCTGCTGCCCAAAGGGAGCAAGGAGGAACAGCGGGATTACGTCTTCTACCTGGCCGTGGGGAACTACCGGCTCAAGGAATACGAGAAGGCCTTAAAGTACGTCCGCGGGTTGCTGCAGACAGAGCCCCAGAACAACCAGGCCAAGGAACTGGAGCGGCTCATTGACAAGGCCATGAAGAAAGATGGACTCGTGGGCATGGCCATCGTGGGAGGCATGGCCCTGGGTGTGGCGGGACTGGCCGGACTCATCGGACTTGCTGTGTCCAAGTCCAAATCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0847-Ab Anti-FIS1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0847-Ag FIS1 protein
    ORF Viral Vector pGMAD000048 Rat Fis1 Adenovirus plasmid
    ORF Viral Vector pGMAD000275 Human FIS1 Adenovirus plasmid
    ORF Viral Vector pGMLP002675 Human FIS1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-093 Human FIS1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-233 Human FIS1 Adenovirus plasmid
    ORF Viral Vector vGMAD000048 Rat Fis1 Adenovirus particle
    ORF Viral Vector vGMAD000275 Human FIS1 Adenovirus particle
    ORF Viral Vector vGMLP002675 Human FIS1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-093 Human FIS1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-233 Human FIS1 Adenovirus particle


    Target information

    Target ID GM-IP0847
    Target Name FIS1
    Gene ID 51024, 66437, 714444, 288584, 101081944, 479728, 615565, 100059592
    Gene Symbol and Synonyms 2010003O14Rik,CGI-135,FIS1,TTC11
    Uniprot Accession Q9Y3D6
    Uniprot Entry Name FIS1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000214253
    Target Classification Not Available

    The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.