Human IL6/BSF-2/ BSF2 ORF/cDNA clone-Lentivirus plasmid (NM_000600)
Pre-made Human IL6/BSF-2/ BSF2 Lentiviral expression plasmid for IL6 lentivirus packaging, IL6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL6/BSF-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000469 | Human IL6 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000469 |
Gene Name | IL6 |
Accession Number | NM_000600 |
Gene ID | 3569 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 639 bp |
Gene Alias | BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCTTCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTAACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTTTTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTGTGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T32578 |
Target Name | IL6 |
Gene ID | 3569, 16193, 705819, 24498, 493687, 403985, 280826, 100034196 |
Gene Symbol and Synonyms | BSF-2,BSF2,CDF,HGF,HSF,IFN-beta-2,IFNB2,IL-6,IL6,ILg6 |
Uniprot Accession | P05231 |
Uniprot Entry Name | IL6_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Urolithiasis, Acute kidney failure, Diabetic Nephropathy, Interstitial cystitis (chronic), Malignant neoplasm of bladder, Overactive bladder, Type 1 diabetes mellitus, Urinary bladder urothelial carcinoma, Urinary Tract Infection |
Gene Ensembl | ENSG00000136244 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a cytokine that functions in inflammation and the maturation of B cells. In addition, the encoded protein has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. The protein is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces a transcriptional inflammatory response through interleukin 6 receptor, alpha. The functioning of this gene is implicated in a wide variety of inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. Elevated levels of the encoded protein have been found in virus infections, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.