Human IL6/BSF-2/ BSF2 ORF/cDNA clone-Lentivirus particle (NM_000600)

Pre-made Human IL6/BSF-2/ BSF2 Lentiviral expression plasmid for IL6 lentivirus packaging, IL6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL6/BSF-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000469 Human IL6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000469
Gene Name IL6
Accession Number NM_000600
Gene ID 3569
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 639 bp
Gene Alias BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCTTCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTAACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTTTTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTGTGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-932 Pre-Made Olamkicept Biosimilar, Fusion Protein targeting IL6 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6
    Biosimilar GMP-Bios-ab-646 Pre-Made Ziltivekimab biosimilar, Whole mAb, Anti-IL6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Biosimilar GMP-Bios-ab-520 Pre-Made Siltuximab biosimilar, Whole mAb, Anti-IL6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Biosimilar GMP-Bios-INN-831 Pre-Made Elsilimomab Biosimilar, Whole Mab, Anti-Il6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Biosimilar GMP-Bios-ab-525 Pre-Made Sirukumab biosimilar, Whole mAb, Anti-IL6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Biosimilar GMP-Bios-ab-110 Pre-Made Clazakizumab biosimilar, Whole mAb, Anti-IL6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Biosimilar GMP-Bios-ab-397 Pre-Made Olokizumab biosimilar, Whole mAb, Anti-IL6 Antibody: Anti-BSF-2/BSF2/CDF/HGF/HSF/IFN-beta-2/IFNB2/IL-6 therapeutic antibody
    Target Antibody GM-Tg-g-T32578-Ab Anti-IL6/ BSF-2/ BSF2 functional antibody
    Target Antigen GM-Tg-g-T32578-Ag IL6 protein
    Cytokine cks-Tg-g-GM-T32578 Interleukin 6 (IL6) protein & antibody
    ORF Viral Vector pGMLV000053 Human IL6 Lentivirus plasmid
    ORF Viral Vector pGMLP000469 Human IL6 Lentivirus plasmid
    ORF Viral Vector pGMAP000315 Human IL6 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-009 Human IL6 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-092 Human IL6 Adenovirus plasmid
    ORF Viral Vector vGMLV000053 Human IL6 Lentivirus particle
    ORF Viral Vector vGMLP000469 Human IL6 Lentivirus particle
    ORF Viral Vector vGMAP000315 Human IL6 Adenovirus particle
    ORF Viral Vector vGMLP-IL-009 Human IL6 Lentivirus particle
    ORF Viral Vector vGMAP-IL-092 Human IL6 Adenovirus particle


    Target information

    Target ID GM-T32578
    Target Name IL6
    Gene ID 3569, 16193, 705819, 24498, 493687, 403985, 280826, 100034196
    Gene Symbol and Synonyms BSF-2,BSF2,CDF,HGF,HSF,IFN-beta-2,IFNB2,IL-6,IL6,ILg6
    Uniprot Accession P05231
    Uniprot Entry Name IL6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Urolithiasis, Acute kidney failure, Diabetic Nephropathy, Interstitial cystitis (chronic), Malignant neoplasm of bladder, Overactive bladder, Type 1 diabetes mellitus, Urinary bladder urothelial carcinoma, Urinary Tract Infection
    Gene Ensembl ENSG00000136244
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a cytokine that functions in inflammation and the maturation of B cells. In addition, the encoded protein has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. The protein is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces a transcriptional inflammatory response through interleukin 6 receptor, alpha. The functioning of this gene is implicated in a wide variety of inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. Elevated levels of the encoded protein have been found in virus infections, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.