Human AREG/AR/ AREGB ORF/cDNA clone-Lentivirus plasmid (NM_001657)

Pre-made Human AREG/AR/ AREGB Lentiviral expression plasmid for AREG lentivirus packaging, AREG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to AREG/AR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000520 Human AREG Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000520
Gene Name AREG
Accession Number NM_001657
Gene ID 374
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 759 bp
Gene Alias AR, AREGB, CRDGF, SDGF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGAGCCCCGCTGCTACCGCCGGCGCCGGTGGTGCTGTCGCTCTTGATACTCGGCTCAGGCCATTATGCTGCTGGATTGGACCTCAATGACACCTACTCTGGGAAGCGTGAACCATTTTCTGGGGACCACAGTGCTGATGGATTTGAGGTTACCTCAAGAAGTGAGATGTCTTCAGGGAGTGAGATTTCCCCTGTGAGTGAAATGCCTTCTAGTAGTGAACCGTCCTCGGGAGCCGACTATGACTACTCAGAAGAGTATGATAACGAACCACAAATACCTGGCTATATTGTCGATGATTCAGTCAGAGTTGAACAGGTAGTTAAGCCCCCCCAAAACAAGACGGAAAGTGAAAATACTTCAGATAAACCCAAAAGAAAGAAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92834-Ab Anti-AREG/ ARB/ CRDGF functional antibody
    Target Antigen GM-Tg-g-T92834-Ag AREG protein
    Cytokine cks-Tg-g-GM-T92834 amphiregulin (AREG) protein & antibody
    ORF Viral Vector pGMLP000520 Human AREG Lentivirus plasmid
    ORF Viral Vector pGMAP000225 Human AREG Adenovirus plasmid
    ORF Viral Vector vGMLP000520 Human AREG Lentivirus particle
    ORF Viral Vector vGMAP000225 Human AREG Adenovirus particle


    Target information

    Target ID GM-T92834
    Target Name AREG
    Gene ID 374, 11839, 702396, 29183, 101081041, 475176, 538751, 100050528
    Gene Symbol and Synonyms AR,AREG,AREGB,CRDGF,Mcub,SDGF
    Uniprot Accession P15514
    Uniprot Entry Name AREG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000109321
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the epidermal growth factor family. It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells and fibroblasts. It is related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). The protein interacts with the EGF/TGF-alpha receptor to promote the growth of normal epithelial cells, and it inhibits the growth of certain aggressive carcinoma cell lines. It also functions in mammary gland, oocyte and bone tissue development. This gene is associated with a psoriasis-like skin phenotype, and is also associated with other pathological disorders, including various types of cancers and inflammatory conditions. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.