Human AREG/AR/ CRDGF ORF/cDNA clone-Adenovirus particle (BC009799)
Pre-made Human AREG/AR/ CRDGF Adenovirus for AREG overexpression in-vitro and in-vivo. The AREG adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AREG-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to AREG/AR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000225 | Human AREG Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000225 |
Gene Name | AREG |
Accession Number | BC009799 |
Gene ID | 374 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 759 bp |
Gene Alias | AR, CRDGF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGAGCCCCGCTGCTACCGCCGGCGCCGGTGGTGCTGTCGCTCTTGATACTCGGCTCAGGCCATTATGCTGCTGGATTGGACCTCAATGACACCTACTCTGGGAAGCGTGAACCATTTTCTGGGGACCACAGTGCTGATGGATTTGAGGTTACCTCAAGAAGTGAGATGTCTTCAGGGAGTGAGATTTCCCCTGTGAGTGAAATGCCTTCTAGTAGTGAACCGTCCTCGGGAGCCGACTATGACTACTCAGAAGAGTATGATAACGAACCACAAATACCTGGCTATATTGTCGATGATTCAGTCAGAGTTGAACAGGTAGTTAAGCCCCCCCAAAACAAGACGGAAAGTGAAAATACTTCAGATAAACCCAAAAGAAAGAAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T92834-Ab | Anti-AREG/ ARB/ CRDGF functional antibody |
Target Antigen | GM-Tg-g-T92834-Ag | AREG protein |
Cytokine | cks-Tg-g-GM-T92834 | amphiregulin (AREG) protein & antibody |
ORF Viral Vector | pGMLP000520 | Human AREG Lentivirus plasmid |
ORF Viral Vector | pGMAP000225 | Human AREG Adenovirus plasmid |
ORF Viral Vector | vGMLP000520 | Human AREG Lentivirus particle |
ORF Viral Vector | vGMAP000225 | Human AREG Adenovirus particle |
Target information
Target ID | GM-T92834 |
Target Name | AREG |
Gene ID | 374, 11839, 702396, 29183, 101081041, 475176, 538751, 100050528 |
Gene Symbol and Synonyms | AR,AREG,AREGB,CRDGF,Mcub,SDGF |
Uniprot Accession | P15514 |
Uniprot Entry Name | AREG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000109321 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the epidermal growth factor family. It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells and fibroblasts. It is related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). The protein interacts with the EGF/TGF-alpha receptor to promote the growth of normal epithelial cells, and it inhibits the growth of certain aggressive carcinoma cell lines. It also functions in mammary gland, oocyte and bone tissue development. This gene is associated with a psoriasis-like skin phenotype, and is also associated with other pathological disorders, including various types of cancers and inflammatory conditions. [provided by RefSeq, Apr 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.