Human AREG/AR/ AREGB ORF/cDNA clone-Lentivirus particle (NM_001657)
Pre-made Human AREG/AR/ AREGB Lentiviral expression plasmid for AREG lentivirus packaging, AREG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to AREG/AR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000520 | Human AREG Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000520 |
Gene Name | AREG |
Accession Number | NM_001657 |
Gene ID | 374 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 759 bp |
Gene Alias | AR, AREGB, CRDGF, SDGF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGAGCCCCGCTGCTACCGCCGGCGCCGGTGGTGCTGTCGCTCTTGATACTCGGCTCAGGCCATTATGCTGCTGGATTGGACCTCAATGACACCTACTCTGGGAAGCGTGAACCATTTTCTGGGGACCACAGTGCTGATGGATTTGAGGTTACCTCAAGAAGTGAGATGTCTTCAGGGAGTGAGATTTCCCCTGTGAGTGAAATGCCTTCTAGTAGTGAACCGTCCTCGGGAGCCGACTATGACTACTCAGAAGAGTATGATAACGAACCACAAATACCTGGCTATATTGTCGATGATTCAGTCAGAGTTGAACAGGTAGTTAAGCCCCCCCAAAACAAGACGGAAAGTGAAAATACTTCAGATAAACCCAAAAGAAAGAAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T92834-Ab | Anti-AREG/ ARB/ CRDGF functional antibody |
Target Antigen | GM-Tg-g-T92834-Ag | AREG protein |
Cytokine | cks-Tg-g-GM-T92834 | amphiregulin (AREG) protein & antibody |
ORF Viral Vector | pGMLP000520 | Human AREG Lentivirus plasmid |
ORF Viral Vector | pGMAP000225 | Human AREG Adenovirus plasmid |
ORF Viral Vector | vGMLP000520 | Human AREG Lentivirus particle |
ORF Viral Vector | vGMAP000225 | Human AREG Adenovirus particle |
Target information
Target ID | GM-T92834 |
Target Name | AREG |
Gene ID | 374, 11839, 702396, 29183, 101081041, 475176, 538751, 100050528 |
Gene Symbol and Synonyms | AR,AREG,AREGB,CRDGF,Mcub,SDGF |
Uniprot Accession | P15514 |
Uniprot Entry Name | AREG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000109321 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the epidermal growth factor family. It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells and fibroblasts. It is related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). The protein interacts with the EGF/TGF-alpha receptor to promote the growth of normal epithelial cells, and it inhibits the growth of certain aggressive carcinoma cell lines. It also functions in mammary gland, oocyte and bone tissue development. This gene is associated with a psoriasis-like skin phenotype, and is also associated with other pathological disorders, including various types of cancers and inflammatory conditions. [provided by RefSeq, Apr 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.