Human PRTN3/ACPA/ AGP7 ORF/cDNA clone-Lentivirus plasmid (NM_002777)
Pre-made Human PRTN3/ACPA/ AGP7 Lentiviral expression plasmid for PRTN3 lentivirus packaging, PRTN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PRTN3/ACPA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000548 | Human PRTN3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000548 |
Gene Name | PRTN3 |
Accession Number | NM_002777 |
Gene ID | 5657 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 771 bp |
Gene Alias | ACPA, AGP7, C-ANCA, CANCA, MBN, MBT, NP-4, NP4, P29, PR-3, PR3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTCACCGGCCCCCCAGCCCTGCCCTGGCGTCCGTGCTGCTGGCCTTGCTGCTGAGCGGTGCTGCCCGAGCTGCGGAGATCGTGGGCGGGCACGAGGCGCAGCCACACTCCCGGCCCTACATGGCCTCCCTGCAGATGCGGGGGAACCCGGGCAGCCACTTCTGCGGAGGCACCTTGATCCACCCCAGCTTCGTGCTGACGGCCGCGCACTGCCTGCGGGACATACCCCAGCGCCTGGTGAACGTGGTGCTCGGAGCCCACAACGTGCGGACGCAGGAGCCCACCCAGCAGCACTTCTCGGTGGCTCAGGTGTTTCTGAACAACTACGACGCGGAGAACAAACTGAACGACGTTCTCCTCATCCAGCTGAGCAGCCCAGCCAACCTCAGTGCCTCCGTCGCCACAGTCCAGCTGCCACAGCAGGACCAGCCAGTGCCCCACGGCACCCAGTGCCTGGCCATGGGCTGGGGCCGCGTGGGTGCCCACGACCCCCCAGCCCAGGTCCTGCAGGAGCTCAATGTCACCGTGGTCACCTTCTTCTGCCGGCCACATAACATTTGCACTTTCGTCCCTCGCCGCAAGGCCGGCATCTGCTTCGGAGACTCAGGTGGCCCCCTGATCTGTGATGGCATCATCCAAGGAATAGACTCCTTCGTGATCTGGGGATGTGCCACCCGCCTTTTCCCTGACTTCTTCACGCGGGTAGCCCTCTACGTGGACTGGATCCGTTCCACGCTGCGCCGTGTGGAGGCCAAGGGCCGCCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15882-Ab | Anti-PRTN3/ ACPA/ AGP7 monoclonal antibody |
Target Antigen | GM-Tg-g-T15882-Ag | PRTN3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000548 | Human PRTN3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000488 | Human PRTN3 Adenovirus plasmid |
ORF Viral Vector | vGMLP000548 | Human PRTN3 Lentivirus particle |
ORF Viral Vector | vGMAP000488 | Human PRTN3 Adenovirus particle |
Target information
Target ID | GM-T15882 |
Target Name | PRTN3 |
Gene ID | 5657, 19152, 721131, 100298591, 100147215 |
Gene Symbol and Synonyms | ACPA,AGP7,C-ANCA,CANCA,MBN,MBT,mPR3,NP-4,NP4,P29,PR-3,PR3,PRTN3 |
Uniprot Accession | P24158 |
Uniprot Entry Name | PRTN3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Cancer |
Gene Ensembl | ENSG00000196415 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
Enables enzyme binding activity; serine-type endopeptidase activity; and signaling receptor binding activity. Involved in several processes, including mature conventional dendritic cell differentiation; membrane protein ectodomain proteolysis; and neutrophil extravasation. Located in azurophil granule lumen; cytosol; and plasma membrane raft. Colocalizes with plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.