Human PRTN3/ACPA/ AGP7 ORF/cDNA clone-Lentivirus particle (NM_002777)

Pre-made Human PRTN3/ACPA/ AGP7 Lentiviral expression plasmid for PRTN3 lentivirus packaging, PRTN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PRTN3/ACPA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000548 Human PRTN3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000548
Gene Name PRTN3
Accession Number NM_002777
Gene ID 5657
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 771 bp
Gene Alias ACPA, AGP7, C-ANCA, CANCA, MBN, MBT, NP-4, NP4, P29, PR-3, PR3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCACCGGCCCCCCAGCCCTGCCCTGGCGTCCGTGCTGCTGGCCTTGCTGCTGAGCGGTGCTGCCCGAGCTGCGGAGATCGTGGGCGGGCACGAGGCGCAGCCACACTCCCGGCCCTACATGGCCTCCCTGCAGATGCGGGGGAACCCGGGCAGCCACTTCTGCGGAGGCACCTTGATCCACCCCAGCTTCGTGCTGACGGCCGCGCACTGCCTGCGGGACATACCCCAGCGCCTGGTGAACGTGGTGCTCGGAGCCCACAACGTGCGGACGCAGGAGCCCACCCAGCAGCACTTCTCGGTGGCTCAGGTGTTTCTGAACAACTACGACGCGGAGAACAAACTGAACGACGTTCTCCTCATCCAGCTGAGCAGCCCAGCCAACCTCAGTGCCTCCGTCGCCACAGTCCAGCTGCCACAGCAGGACCAGCCAGTGCCCCACGGCACCCAGTGCCTGGCCATGGGCTGGGGCCGCGTGGGTGCCCACGACCCCCCAGCCCAGGTCCTGCAGGAGCTCAATGTCACCGTGGTCACCTTCTTCTGCCGGCCACATAACATTTGCACTTTCGTCCCTCGCCGCAAGGCCGGCATCTGCTTCGGAGACTCAGGTGGCCCCCTGATCTGTGATGGCATCATCCAAGGAATAGACTCCTTCGTGATCTGGGGATGTGCCACCCGCCTTTTCCCTGACTTCTTCACGCGGGTAGCCCTCTACGTGGACTGGATCCGTTCCACGCTGCGCCGTGTGGAGGCCAAGGGCCGCCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15882-Ab Anti-PRTN3/ ACPA/ AGP7 monoclonal antibody
    Target Antigen GM-Tg-g-T15882-Ag PRTN3 VLP (virus-like particle)
    ORF Viral Vector pGMLP000548 Human PRTN3 Lentivirus plasmid
    ORF Viral Vector pGMAP000488 Human PRTN3 Adenovirus plasmid
    ORF Viral Vector vGMLP000548 Human PRTN3 Lentivirus particle
    ORF Viral Vector vGMAP000488 Human PRTN3 Adenovirus particle


    Target information

    Target ID GM-T15882
    Target Name PRTN3
    Gene ID 5657, 19152, 721131, 100298591, 100147215
    Gene Symbol and Synonyms ACPA,AGP7,C-ANCA,CANCA,MBN,MBT,mPR3,NP-4,NP4,P29,PR-3,PR3,PRTN3
    Uniprot Accession P24158
    Uniprot Entry Name PRTN3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000196415
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    Enables enzyme binding activity; serine-type endopeptidase activity; and signaling receptor binding activity. Involved in several processes, including mature conventional dendritic cell differentiation; membrane protein ectodomain proteolysis; and neutrophil extravasation. Located in azurophil granule lumen; cytosol; and plasma membrane raft. Colocalizes with plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.