Human STX3/STX3A ORF/cDNA clone-Lentivirus plasmid (NM_004177)
Cat. No.: pGMLP000571
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human STX3/STX3A Lentiviral expression plasmid for STX3 lentivirus packaging, STX3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
STX3/STX3A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000571 |
Gene Name | STX3 |
Accession Number | NM_004177 |
Gene ID | 6809 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 870 bp |
Gene Alias | STX3A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGGACCGTCTGGAGCAGCTGAAGGCCAAGCAGCTGACACAGGATGATGATACTGATGCGGTTGAGATTGCTATCGACAACACGGCTTTTATGGACGAGTTCTTTTCTGAGATTGAGGAAACTCGGCTTAACATTGACAAGATCTCAGAACATGTAGAGGAGGCTAAGAAACTCTACAGTATCATTCTCTCTGCACCGATTCCAGAGCCAAAAACCAAGGATGACCTAGAGCAGCTCACGACTGAGATTAAGAAAAGGGCCAACAACGTCCGGAACAAACTGAAGAGCATGGAGAAGCATATTGAAGAAGATGAGGTCAGGTCATCGGCAGACCTTCGGATTCGGAAATCCCAGCACTCTGTCCTTTCTCGGAAGTTTGTGGAGGTGATGACCAAATACAATGAAGCTCAAGTGGACTTCCGAGAACGCAGCAAAGGGCGAATCCAGCGGCAGCTCGAAATTACTGGCAAAAAGACAACCGATGAGGAGCTGGAGGAGATGTTGGAGAGTGGCAACCCGGCCATCTTCACTTCTGGGATCATTGACTCACAGATTTCCAAGCAAGCCCTCAGTGAGATTGAGGGACGACACAAGGACATTGTGAGGCTGGAGAGCAGCATCAAGGAGCTTCACGACATGTTTATGGACATCGCCATGCTGGTGGAGAATCAGGGTGAGATGTTAGATAACATAGAGTTGAATGTCATGCACACAGTGGACCACGTGGAGAAGGCACGAGATGAAACGAAAAAAGCTGTGAAATACCAGAGTCAGGCCCGGAAGAAATTGATAATTATCATTGTGCTAGTAGTTGTGTTGCTGGGCATTTTAGCATTGATTATTGGACTTTCCGTTGGGCTGAATTAA |
ORF Protein Sequence | MKDRLEQLKAKQLTQDDDTDAVEIAIDNTAFMDEFFSEIEETRLNIDKISEHVEEAKKLYSIILSAPIPEPKTKDDLEQLTTEIKKRANNVRNKLKSMEKHIEEDEVRSSADLRIRKSQHSVLSRKFVEVMTKYNEAQVDFRERSKGRIQRQLEITGKKTTDEELEEMLESGNPAIFTSGIIDSQISKQALSEIEGRHKDIVRLESSIKELHDMFMDIAMLVENQGEMLDNIELNVMHTVDHVEKARDETKKAVKYQSQARKKLIIIIVLVVVLLGILALIIGLSVGLN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1727-Ab | Anti-STX3/ STX3A monoclonal antibody |
Target Antigen | GM-Tg-g-MP1727-Ag | STX3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000571 | Human STX3 Lentivirus plasmid |
ORF Viral Vector | vGMLP000571 | Human STX3 Lentivirus particle |
Target information
Target ID | GM-MP1727 |
Target Name | STX3 |
Gene ID | 6809, 20908, 698953, 81802, 101099148, 100855648, 513275, 100060878 |
Gene Symbol and Synonyms | DIAR12,MVID2,RDMVID,STX3,STX3A,Syn-3 |
Uniprot Accession | Q13277 |
Uniprot Entry Name | STX3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000166900 |
Target Classification | Not Available |
The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.