Human STX3/STX3A ORF/cDNA clone-Lentivirus particle (NM_004177)

Cat. No.: vGMLP000571

Pre-made Human STX3/STX3A Lentiviral expression plasmid for STX3 lentivirus packaging, STX3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to STX3/STX3A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000571 Human STX3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000571
Gene Name STX3
Accession Number NM_004177
Gene ID 6809
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 870 bp
Gene Alias STX3A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGACCGTCTGGAGCAGCTGAAGGCCAAGCAGCTGACACAGGATGATGATACTGATGCGGTTGAGATTGCTATCGACAACACGGCTTTTATGGACGAGTTCTTTTCTGAGATTGAGGAAACTCGGCTTAACATTGACAAGATCTCAGAACATGTAGAGGAGGCTAAGAAACTCTACAGTATCATTCTCTCTGCACCGATTCCAGAGCCAAAAACCAAGGATGACCTAGAGCAGCTCACGACTGAGATTAAGAAAAGGGCCAACAACGTCCGGAACAAACTGAAGAGCATGGAGAAGCATATTGAAGAAGATGAGGTCAGGTCATCGGCAGACCTTCGGATTCGGAAATCCCAGCACTCTGTCCTTTCTCGGAAGTTTGTGGAGGTGATGACCAAATACAATGAAGCTCAAGTGGACTTCCGAGAACGCAGCAAAGGGCGAATCCAGCGGCAGCTCGAAATTACTGGCAAAAAGACAACCGATGAGGAGCTGGAGGAGATGTTGGAGAGTGGCAACCCGGCCATCTTCACTTCTGGGATCATTGACTCACAGATTTCCAAGCAAGCCCTCAGTGAGATTGAGGGACGACACAAGGACATTGTGAGGCTGGAGAGCAGCATCAAGGAGCTTCACGACATGTTTATGGACATCGCCATGCTGGTGGAGAATCAGGGTGAGATGTTAGATAACATAGAGTTGAATGTCATGCACACAGTGGACCACGTGGAGAAGGCACGAGATGAAACGAAAAAAGCTGTGAAATACCAGAGTCAGGCCCGGAAGAAATTGATAATTATCATTGTGCTAGTAGTTGTGTTGCTGGGCATTTTAGCATTGATTATTGGACTTTCCGTTGGGCTGAATTAA
ORF Protein Sequence MKDRLEQLKAKQLTQDDDTDAVEIAIDNTAFMDEFFSEIEETRLNIDKISEHVEEAKKLYSIILSAPIPEPKTKDDLEQLTTEIKKRANNVRNKLKSMEKHIEEDEVRSSADLRIRKSQHSVLSRKFVEVMTKYNEAQVDFRERSKGRIQRQLEITGKKTTDEELEEMLESGNPAIFTSGIIDSQISKQALSEIEGRHKDIVRLESSIKELHDMFMDIAMLVENQGEMLDNIELNVMHTVDHVEKARDETKKAVKYQSQARKKLIIIIVLVVVLLGILALIIGLSVGLN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1727-Ab Anti-STX3/ STX3A monoclonal antibody
    Target Antigen GM-Tg-g-MP1727-Ag STX3 VLP (virus-like particle)
    ORF Viral Vector pGMLP000571 Human STX3 Lentivirus plasmid
    ORF Viral Vector vGMLP000571 Human STX3 Lentivirus particle


    Target information

    Target ID GM-MP1727
    Target Name STX3
    Gene ID 6809, 20908, 698953, 81802, 101099148, 100855648, 513275, 100060878
    Gene Symbol and Synonyms DIAR12,MVID2,RDMVID,STX3,STX3A,Syn-3
    Uniprot Accession Q13277
    Uniprot Entry Name STX3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166900
    Target Classification Not Available

    The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.