Human MS4A1/B1/ Bp35 ORF/cDNA clone-Lentivirus plasmid (NM_021950)

Pre-made Human MS4A1/B1/ Bp35 Lentiviral expression plasmid for MS4A1 lentivirus packaging, MS4A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CD20/MS4A1/B1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000581 Human MS4A1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000581
Gene Name MS4A1
Accession Number NM_021950
Gene ID 931
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 894 bp
Gene Alias B1, Bp35, CD20, CVID5, LEU-16, MS4A2, S7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACAACACCCAGAAATTCAGTAAATGGGACTTTCCCGGCAGAGCCAATGAAAGGCCCTATTGCTATGCAATCTGGTCCAAAACCACTCTTCAGGAGGATGTCTTCACTGGTGGGCCCCACGCAAAGCTTCTTCATGAGGGAATCTAAGACTTTGGGGGCTGTCCAGATTATGAATGGGCTCTTCCACATTGCCCTGGGGGGTCTTCTGATGATCCCAGCAGGGATCTATGCACCCATCTGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTCCTGGCAGCAACGGAGAAAAACTCCAGGAAGTGTTTGGTCAAAGGAAAAATGATAATGAATTCATTGAGCCTCTTTGCTGCCATTTCTGGAATGATTCTTTCAATCATGGACATACTTAATATTAAAATTTCCCATTTTTTAAAAATGGAGAGTCTGAATTTTATTAGAGCTCACACACCATATATTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACCCAATACTGTTACAGCATACAATCTCTGTTCTTGGGCATTTTGTCAGTGATGCTGATCTTTGCCTTCTTCCAGGAACTTGTAATAGCTGGCATCGTTGAGAATGAATGGAAAAGAACGTGCTCCAGACCCAAATCTAACATAGTTCTCCTGTCAGCAGAAGAAAAAAAAGAACAGACTATTGAAATAAAAGAAGAAGTGGTTGGGCTAACTGAAACATCTTCCCAACCAAAGAATGAAGAAGACATTGAAATTATTCCAATCCAAGAAGAGGAAGAAGAAGAAACAGAGACGAACTTTCCAGAACCTCCCCAAGATCAGGAATCCTCACCAATAGAAAATGACAGCTCTCCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-356 Pre-Made Mosunetuzumab biosimilar, Bispecific mAb, Anti-CD3E;MS4A1/CD20 Antibody: Anti-T3E/TCRE/IMD18/CD3epsilon;B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-385 Pre-Made Obinutuzumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-INN-859 Pre-Made Ibritumomab Tiuxetan Biosimilar, Radiolabelled Antibody, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-192 Pre-Made Eramkafusp biosimilar, Whole mAb Fusion, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-149 Pre-Made Divozilimab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-391 Pre-Made Odronextamab biosimilar, Bispecific mAb, Anti-MS4A1/CD20;CD3E Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-387 Pre-Made Ocaratuzumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-248 Pre-Made Glofitamab biosimilar, Bispecific mAb with Domain Crossover, Anti-CD3E;MS4A1/CD20 antibody: Anti-T3E/TCRE/IMD18/CD3epsilon;B1/Bp35/CVID5/FMC7/LEU-16/S7therapeutic antibody
    Biosimilar GMP-Bios-ab-446 Pre-Made Plamotamab biosimilar, Bispecific Mixed mAb and scFv, Anti-MS4A1/CD20;CD3E Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-617 Pre-Made Veltuzumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-651 Pre-Made Zuberitamab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-INN-843 Pre-Made Eramkafusp Alfa Biosimilar, Fusion Protein targeting MS4A1/CD20 fused with human IFNA2 (interferon alpha 2) via a peptidyl linker: Recombinant therapeutic protein targeting B1/Bp35/CVID5/FMC7/LEU-16/S7
    Biosimilar GMP-Bios-ab-392 Pre-Made Ofatumumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-189 Pre-Made Epcoritamab biosimilar, Bispecific mAb, Anti-CD3E;MS4A1/CD20 Antibody: Anti-T3E/TCRE/IMD18/CD3epsilon;B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-389 Pre-Made Ocrelizumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-013 Pre-Made Afutuzumab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-075 Pre-Made Blontuvetmab biosimilar, Canine Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-INN-1012 Pre-Made Technetium (99Mtc) Nofetumomab Merpentan Biosimilar, Radiolabelled Antibody: Anti-MS4A1/CD20 therapeutic antibody
    Biosimilar GMP-Bios-INN-1028 Pre-Made Tositumomab Biosimilar, Radiolabelled Antibody, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-598 Pre-Made Ublituximab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-485 Pre-Made Ripertamab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-ab-487 Pre-Made Rituximab biosimilar, Whole mAb, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Biosimilar GMP-Bios-INN-838 Pre-Made Epitumomab Biosimilar, Whole Mab, Anti-MS4A1/CD20 Antibody: Anti-B1/Bp35/CVID5/FMC7/LEU-16/S7 therapeutic antibody
    Target Antibody GM-Tg-g-T73215-Ab Anti-CD20/ MS4A1/ B1 monoclonal antibody
    Target Antigen GM-Tg-g-T73215-Ag CD20/MS4A1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000581 Human MS4A1 Lentivirus plasmid
    ORF Viral Vector vGMLP000581 Human MS4A1 Lentivirus particle


    Target information

    Target ID GM-T73215
    Target Name CD20
    Gene ID 931, 12482, 696843, 309217, 494216, 505653, 100059000
    Gene Symbol and Synonyms B1,Bp35,CD20,CVID5,FMC7,LEU-16,Ly-44,MS4A1,Ms4a2,S7
    Uniprot Accession P11836
    Uniprot Entry Name CD20_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000156738
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.