Human CCR6/BN-1/ C-C CKR-6 ORF/cDNA clone-Lentivirus plasmid (NM_031409)
Pre-made Human CCR6/BN-1/ C-C CKR-6 Lentiviral expression plasmid for CCR6 lentivirus packaging, CCR6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCR6/BN-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000600 | Human CCR6 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000600 |
Gene Name | CCR6 |
Accession Number | NM_031409 |
Gene ID | 1235 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1125 bp |
Gene Alias | BN-1, C-C CKR-6, CC-CKR-6, CCR-6, CD196, CKR-L3, CKRL3, CMKBR6, DCR2, DRY6, GPR29, GPRCY4, STRL22 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCGGGGAATCAATGAATTTCAGCGATGTTTTCGACTCCAGTGAAGATTATTTTGTGTCAGTCAATACTTCATATTACTCAGTTGATTCTGAGATGTTACTGTGCTCCTTGCAGGAGGTCAGGCAGTTCTCCAGGCTATTTGTACCGATTGCCTACTCCTTGATCTGTGTCTTTGGCCTCCTGGGGAATATTCTGGTGGTGATCACCTTTGCTTTTTATAAGAAGGCCAGGTCTATGACAGACGTCTATCTCTTGAACATGGCCATTGCAGACATCCTCTTTGTTCTTACTCTCCCATTCTGGGCAGTGAGTCATGCCACCGGTGCGTGGGTTTTCAGCAATGCCACGTGCAAGTTGCTAAAAGGCATCTATGCCATCAACTTTAACTGCGGGATGCTGCTCCTGACTTGCATTAGCATGGACCGGTACATCGCCATTGTACAGGCGACTAAGTCATTCCGGCTCCGATCCAGAACACTACCGCGCAGCAAAATCATCTGCCTTGTTGTGTGGGGGCTGTCAGTCATCATCTCCAGCTCAACTTTTGTCTTCAACCAAAAATACAACACCCAAGGCAGCGATGTCTGTGAACCCAAGTACCAGACTGTCTCGGAGCCCATCAGGTGGAAGCTGCTGATGTTGGGGCTTGAGCTACTCTTTGGTTTCTTTATCCCTTTGATGTTCATGATATTTTGTTACACGTTCATTGTCAAAACCTTGGTGCAAGCTCAGAATTCTAAAAGGCACAAAGCCATCCGTGTAATCATAGCTGTGGTGCTTGTGTTTCTGGCTTGTCAGATTCCTCATAACATGGTCCTGCTTGTGACGGCTGCAAATTTGGGTAAAATGAACCGATCCTGCCAGAGCGAAAAGCTAATTGGCTATACGAAAACTGTCACAGAAGTCCTGGCTTTCCTGCACTGCTGCCTGAACCCTGTGCTCTACGCTTTTATTGGGCAGAAGTTCAGAAACTACTTTCTGAAGATCTTGAAGGACCTGTGGTGTGTGAGAAGGAAGTACAAGTCCTCAGGCTTCTCCTGTGCCGGGAGGTACTCAGAAAACATTTCTCGGCAGACCAGTGAGACCGCAGATAACGACAATGCGTCGTCCTTCACTATGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0190-Ab | Anti-CCR6/ BN-1/ C-C CKR-6 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0190-Ag | CCR6 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP0190 | chemokine (C-C motif) receptor 6 (CCR6) protein & antibody |
ORF Viral Vector | pGMLP000600 | Human CCR6 Lentivirus plasmid |
ORF Viral Vector | vGMLP000600 | Human CCR6 Lentivirus particle |
Target information
Target ID | GM-MP0190 |
Target Name | CCR6 |
Gene ID | 1235, 12458, 574335, 308163, 101100307, 484080, 519716, 100055159 |
Gene Symbol and Synonyms | BN-1,C-C CKR-6,CC-CKR-6,CCR-6,CCR6,CD196,CKR-L3,CKRL3,CMKBR6,DCR2,DRY6,GPR29,GPRCY4,KY411,STRL22 |
Uniprot Accession | P51684 |
Uniprot Entry Name | CCR6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000112486 |
Target Classification | GPCR, Tumor-associated antigen (TAA) |
This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.