Human CCR6/BN-1/ C-C CKR-6 ORF/cDNA clone-Lentivirus particle (NM_031409)

Pre-made Human CCR6/BN-1/ C-C CKR-6 Lentiviral expression plasmid for CCR6 lentivirus packaging, CCR6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCR6/BN-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000600 Human CCR6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000600
Gene Name CCR6
Accession Number NM_031409
Gene ID 1235
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1125 bp
Gene Alias BN-1, C-C CKR-6, CC-CKR-6, CCR-6, CD196, CKR-L3, CKRL3, CMKBR6, DCR2, DRY6, GPR29, GPRCY4, STRL22
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCGGGGAATCAATGAATTTCAGCGATGTTTTCGACTCCAGTGAAGATTATTTTGTGTCAGTCAATACTTCATATTACTCAGTTGATTCTGAGATGTTACTGTGCTCCTTGCAGGAGGTCAGGCAGTTCTCCAGGCTATTTGTACCGATTGCCTACTCCTTGATCTGTGTCTTTGGCCTCCTGGGGAATATTCTGGTGGTGATCACCTTTGCTTTTTATAAGAAGGCCAGGTCTATGACAGACGTCTATCTCTTGAACATGGCCATTGCAGACATCCTCTTTGTTCTTACTCTCCCATTCTGGGCAGTGAGTCATGCCACCGGTGCGTGGGTTTTCAGCAATGCCACGTGCAAGTTGCTAAAAGGCATCTATGCCATCAACTTTAACTGCGGGATGCTGCTCCTGACTTGCATTAGCATGGACCGGTACATCGCCATTGTACAGGCGACTAAGTCATTCCGGCTCCGATCCAGAACACTACCGCGCAGCAAAATCATCTGCCTTGTTGTGTGGGGGCTGTCAGTCATCATCTCCAGCTCAACTTTTGTCTTCAACCAAAAATACAACACCCAAGGCAGCGATGTCTGTGAACCCAAGTACCAGACTGTCTCGGAGCCCATCAGGTGGAAGCTGCTGATGTTGGGGCTTGAGCTACTCTTTGGTTTCTTTATCCCTTTGATGTTCATGATATTTTGTTACACGTTCATTGTCAAAACCTTGGTGCAAGCTCAGAATTCTAAAAGGCACAAAGCCATCCGTGTAATCATAGCTGTGGTGCTTGTGTTTCTGGCTTGTCAGATTCCTCATAACATGGTCCTGCTTGTGACGGCTGCAAATTTGGGTAAAATGAACCGATCCTGCCAGAGCGAAAAGCTAATTGGCTATACGAAAACTGTCACAGAAGTCCTGGCTTTCCTGCACTGCTGCCTGAACCCTGTGCTCTACGCTTTTATTGGGCAGAAGTTCAGAAACTACTTTCTGAAGATCTTGAAGGACCTGTGGTGTGTGAGAAGGAAGTACAAGTCCTCAGGCTTCTCCTGTGCCGGGAGGTACTCAGAAAACATTTCTCGGCAGACCAGTGAGACCGCAGATAACGACAATGCGTCGTCCTTCACTATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0190-Ab Anti-CCR6/ BN-1/ C-C CKR-6 monoclonal antibody
    Target Antigen GM-Tg-g-MP0190-Ag CCR6 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP0190 chemokine (C-C motif) receptor 6 (CCR6) protein & antibody
    ORF Viral Vector pGMLP000600 Human CCR6 Lentivirus plasmid
    ORF Viral Vector vGMLP000600 Human CCR6 Lentivirus particle


    Target information

    Target ID GM-MP0190
    Target Name CCR6
    Gene ID 1235, 12458, 574335, 308163, 101100307, 484080, 519716, 100055159
    Gene Symbol and Synonyms BN-1,C-C CKR-6,CC-CKR-6,CCR-6,CCR6,CD196,CKR-L3,CKRL3,CMKBR6,DCR2,DRY6,GPR29,GPRCY4,KY411,STRL22
    Uniprot Accession P51684
    Uniprot Entry Name CCR6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000112486
    Target Classification GPCR, Tumor-associated antigen (TAA)

    This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.