Human SSTR2 ORF/cDNA clone-Lentivirus plasmid (NM_001050)
Pre-made Human SSTR2/ Lentiviral expression plasmid for SSTR2 lentivirus packaging, SSTR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SSTR2/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000605 | Human SSTR2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000605 |
Gene Name | SSTR2 |
Accession Number | NM_001050 |
Gene ID | 6752 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1110 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACATGGCGGATGAGCCACTCAATGGAAGCCACACATGGCTATCCATTCCATTTGACCTCAATGGCTCTGTGGTGTCAACCAACACCTCAAACCAGACAGAGCCGTACTATGACCTGACAAGCAATGCAGTCCTCACATTCATCTATTTTGTGGTCTGCATCATTGGGTTGTGTGGCAACACACTTGTCATTTATGTCATCCTCCGCTATGCCAAGATGAAGACCATCACCAACATTTACATCCTCAACCTGGCCATCGCAGATGAGCTCTTCATGCTGGGTCTGCCTTTCTTGGCTATGCAGGTGGCTCTGGTCCACTGGCCCTTTGGCAAGGCCATTTGCCGGGTGGTCATGACTGTGGATGGCATCAATCAGTTCACCAGCATCTTCTGCCTGACAGTCATGAGCATCGACCGATACCTGGCTGTGGTCCACCCCATCAAGTCGGCCAAGTGGAGGAGACCCCGGACGGCCAAGATGATCACCATGGCTGTGTGGGGAGTCTCTCTGCTGGTCATCTTGCCCATCATGATATATGCTGGGCTCCGGAGCAACCAGTGGGGGAGAAGCAGCTGCACCATCAACTGGCCAGGTGAATCTGGGGCTTGGTACACAGGGTTCATCATCTACACTTTCATTCTGGGGTTCCTGGTACCCCTCACCATCATCTGTCTTTGCTACCTGTTCATTATCATCAAGGTGAAGTCCTCTGGAATCCGAGTGGGCTCCTCTAAGAGGAAGAAGTCTGAGAAGAAGGTCACCCGAATGGTGTCCATCGTGGTGGCTGTCTTCATCTTCTGCTGGCTTCCCTTCTACATATTCAACGTTTCTTCCGTCTCCATGGCCATCAGCCCCACCCCAGCCCTTAAAGGCATGTTTGACTTTGTGGTGGTCCTCACCTATGCTAACAGCTGTGCCAACCCTATCCTATATGCCTTCTTGTCTGACAACTTCAAGAAGAGCTTCCAGAATGTCCTCTGCTTGGTCAAGGTGAGCGGCACAGATGATGGGGAGCGGAGTGACAGTAAGCAGGACAAATCCCGGCTGAATGAGACCACGGAGACCCAGAGGACCCTCCTCAATGGAGACCTCCAAACCAGTATCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-570 | Pre-Made Tidutamab biosimilar, Bispecific Mixed mAb and scFv, Anti-SSTR2;CD3E Antibody: Anti-T3E/TCRE/IMD18/CD3epsilon therapeutic antibody |
Target Antibody | GM-Tg-g-T53024-Ab | Anti-SSR2/ SSTR2 monoclonal antibody |
Target Antigen | GM-Tg-g-T53024-Ag | SSTR2 VLP (virus-like particle) |
ORF Viral Vector | pGMPC000270 | Human SSTR2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000605 | Human SSTR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000605 | Human SSTR2 Lentivirus particle |
Target information
Target ID | GM-T53024 |
Target Name | SSTR2 |
Gene ID | 6752, 20606, 695526, 54305, 101090974, 403472, 282083, 100052744 |
Gene Symbol and Synonyms | Smstr-2,Smstr2,SRIF-1,SS2R,SST2,SSTR-2,SSTR2 |
Uniprot Accession | P30874 |
Uniprot Entry Name | SSR2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000180616 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.