Human SSTR2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001050.3)

Pre-made Human SSTR2/ Non-Viral expression plasmid (overexpression vector) for mouse SSTR2 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to SSTR2/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000270 Human SSTR2 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000270
Gene Name SSTR2
Accession Number NM_001050.3
Gene ID 6752
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1110 bp
Gene Alias
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACATGGCGGATGAGCCACTCAATGGAAGCCACACATGGCTATCCATTCCATTTGACCTCAATGGCTCTGTGGTGTCAACCAACACCTCAAACCAGACAGAGCCGTACTATGACCTGACAAGCAATGCAGTCCTCACATTCATCTATTTTGTGGTCTGCATCATTGGGTTGTGTGGCAACACACTTGTCATTTATGTCATCCTCCGCTATGCCAAGATGAAGACCATCACCAACATTTACATCCTCAACCTGGCCATCGCAGATGAGCTCTTCATGCTGGGTCTGCCTTTCTTGGCTATGCAGGTGGCTCTGGTCCACTGGCCCTTTGGCAAGGCCATTTGCCGGGTGGTCATGACTGTGGATGGCATCAATCAGTTCACCAGCATCTTCTGCCTGACAGTCATGAGCATCGACCGATACCTGGCTGTGGTCCACCCCATCAAGTCGGCCAAGTGGAGGAGACCCCGGACGGCCAAGATGATCACCATGGCTGTGTGGGGAGTCTCTCTGCTGGTCATCTTGCCCATCATGATATATGCTGGGCTCCGGAGCAACCAGTGGGGGAGAAGCAGCTGCACCATCAACTGGCCAGGTGAATCTGGGGCTTGGTACACAGGGTTCATCATCTACACTTTCATTCTGGGGTTCCTGGTACCCCTCACCATCATCTGTCTTTGCTACCTGTTCATTATCATCAAGGTGAAGTCCTCTGGAATCCGAGTGGGCTCCTCTAAGAGGAAGAAGTCTGAGAAGAAGGTCACCCGAATGGTGTCCATCGTGGTGGCTGTCTTCATCTTCTGCTGGCTTCCCTTCTACATATTCAACGTTTCTTCCGTCTCCATGGCCATCAGCCCCACCCCAGCCCTTAAAGGCATGTTTGACTTTGTGGTGGTCCTCACCTATGCTAACAGCTGTGCCAACCCTATCCTATATGCCTTCTTGTCTGACAACTTCAAGAAGAGCTTCCAGAATGTCCTCTGCTTGGTCAAGGTGAGCGGCACAGATGATGGGGAGCGGAGTGACAGTAAGCAGGACAAATCCCGGCTGAATGAGACCACGGAGACCCAGAGGACCCTCCTCAATGGAGACCTCCAAACCAGTATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-570 Pre-Made Tidutamab biosimilar, Bispecific Mixed mAb and scFv, Anti-SSTR2;CD3E Antibody: Anti-T3E/TCRE/IMD18/CD3epsilon therapeutic antibody
    Target Antibody GM-Tg-g-T53024-Ab Anti-SSR2/ SSTR2 monoclonal antibody
    Target Antigen GM-Tg-g-T53024-Ag SSTR2 VLP (virus-like particle)
    ORF Viral Vector pGMPC000270 Human SSTR2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000605 Human SSTR2 Lentivirus plasmid
    ORF Viral Vector vGMLP000605 Human SSTR2 Lentivirus particle


    Target information

    Target ID GM-T53024
    Target Name SSTR2
    Gene ID 6752, 20606, 695526, 54305, 101090974, 403472, 282083, 100052744
    Gene Symbol and Synonyms Smstr-2,Smstr2,SRIF-1,SS2R,SST2,SSTR-2,SSTR2
    Uniprot Accession P30874
    Uniprot Entry Name SSR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000180616
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.