Human IL6R/CD126/ gp80 ORF/cDNA clone-Lentivirus plasmid (NM_000565)
Pre-made Human IL6R/CD126/ gp80 Lentiviral expression plasmid for IL6R lentivirus packaging, IL6R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL6R/CD126 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000774 | Human IL6R Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000774 |
Gene Name | IL6R |
Accession Number | NM_000565 |
Gene ID | 3570 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1407 bp |
Gene Alias | CD126, gp80, IL-6R-1, IL-6RA, IL6Q, IL6RA, IL6RQ |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGGCCGTCGGCTGCGCGCTGCTGGCTGCCCTGCTGGCCGCGCCGGGAGCGGCGCTGGCCCCAAGGCGCTGCCCTGCGCAGGAGGTGGCGAGAGGCGTGCTGACCAGTCTGCCAGGAGACAGCGTGACTCTGACCTGCCCGGGGGTAGAGCCGGAAGACAATGCCACTGTTCACTGGGTGCTCAGGAAGCCGGCTGCAGGCTCCCACCCCAGCAGATGGGCTGGCATGGGAAGGAGGCTGCTGCTGAGGTCGGTGCAGCTCCACGACTCTGGAAACTATTCATGCTACCGGGCCGGCCGCCCAGCTGGGACTGTGCACTTGCTGGTGGATGTTCCCCCCGAGGAGCCCCAGCTCTCCTGCTTCCGGAAGAGCCCCCTCAGCAATGTTGTTTGTGAGTGGGGTCCTCGGAGCACCCCATCCCTGACGACAAAGGCTGTGCTCTTGGTGAGGAAGTTTCAGAACAGTCCGGCCGAAGACTTCCAGGAGCCGTGCCAGTATTCCCAGGAGTCCCAGAAGTTCTCCTGCCAGTTAGCAGTCCCGGAGGGAGACAGCTCTTTCTACATAGTGTCCATGTGCGTCGCCAGTAGTGTCGGGAGCAAGTTCAGCAAAACTCAAACCTTTCAGGGTTGTGGAATCTTGCAGCCTGATCCGCCTGCCAACATCACAGTCACTGCCGTGGCCAGAAACCCCCGCTGGCTCAGTGTCACCTGGCAAGACCCCCACTCCTGGAACTCATCTTTCTACAGACTACGGTTTGAGCTCAGATATCGGGCTGAACGGTCAAAGACATTCACAACATGGATGGTCAAGGACCTCCAGCATCACTGTGTCATCCACGACGCCTGGAGCGGCCTGAGGCACGTGGTGCAGCTTCGTGCCCAGGAGGAGTTCGGGCAAGGCGAGTGGAGCGAGTGGAGCCCGGAGGCCATGGGCACGCCTTGGACAGAATCCAGGAGTCCTCCAGCTGAGAACGAGGTGTCCACCCCCATGCAGGCACTTACTACTAATAAAGACGATGATAATATTCTCTTCAGAGATTCTGCAAATGCGACAAGCCTCCCAGTGCAAGATTCTTCTTCAGTACCACTGCCCACATTCCTGGTTGCTGGAGGGAGCCTGGCCTTCGGAACGCTCCTCTGCATTGCCATTGTTCTGAGGTTCAAGAAGACGTGGAAGCTGCGGGCTCTGAAGGAAGGCAAGACAAGCATGCATCCGCCGTACTCTTTGGGGCAGCTGGTCCCGGAGAGGCCTCGACCCACCCCAGTGCTTGTTCCTCTCATCTCCCCACCGGTGTCCCCCAGCAGCCTGGGGTCTGACAATACCTCGAGCCACAACCGACCAGATGCCAGGGACCCACGGAGCCCTTATGACATCAGCAATACAGACTACTTCTTCCCCAGATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-TA027 |
Target Name | IL6R |
Gene ID | 3570, 16194, 716690, 24499, 101085689, 612271, 507359, 102148787 |
Gene Symbol and Synonyms | CD126,gp80,HIES5,IL-1Ra,IL-6R,IL-6R-1,IL-6R-alpha,IL-6RA,IL6Q,IL6QTL,IL6R,IL6R1,IL6RA,IL6RQ |
Uniprot Accession | P08887 |
Uniprot Entry Name | IL6RA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Ovary Cancer, myeloma patients |
Gene Ensembl | ENSG00000160712 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been identified in this gene. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.