Human IL6R/CD126/ gp80 ORF/cDNA clone-Lentivirus particle (NM_000565)

Pre-made Human IL6R/CD126/ gp80 Lentiviral expression plasmid for IL6R lentivirus packaging, IL6R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL6R/CD126 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000774 Human IL6R Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000774
Gene Name IL6R
Accession Number NM_000565
Gene ID 3570
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1407 bp
Gene Alias CD126, gp80, IL-6R-1, IL-6RA, IL6Q, IL6RA, IL6RQ
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGGCCGTCGGCTGCGCGCTGCTGGCTGCCCTGCTGGCCGCGCCGGGAGCGGCGCTGGCCCCAAGGCGCTGCCCTGCGCAGGAGGTGGCGAGAGGCGTGCTGACCAGTCTGCCAGGAGACAGCGTGACTCTGACCTGCCCGGGGGTAGAGCCGGAAGACAATGCCACTGTTCACTGGGTGCTCAGGAAGCCGGCTGCAGGCTCCCACCCCAGCAGATGGGCTGGCATGGGAAGGAGGCTGCTGCTGAGGTCGGTGCAGCTCCACGACTCTGGAAACTATTCATGCTACCGGGCCGGCCGCCCAGCTGGGACTGTGCACTTGCTGGTGGATGTTCCCCCCGAGGAGCCCCAGCTCTCCTGCTTCCGGAAGAGCCCCCTCAGCAATGTTGTTTGTGAGTGGGGTCCTCGGAGCACCCCATCCCTGACGACAAAGGCTGTGCTCTTGGTGAGGAAGTTTCAGAACAGTCCGGCCGAAGACTTCCAGGAGCCGTGCCAGTATTCCCAGGAGTCCCAGAAGTTCTCCTGCCAGTTAGCAGTCCCGGAGGGAGACAGCTCTTTCTACATAGTGTCCATGTGCGTCGCCAGTAGTGTCGGGAGCAAGTTCAGCAAAACTCAAACCTTTCAGGGTTGTGGAATCTTGCAGCCTGATCCGCCTGCCAACATCACAGTCACTGCCGTGGCCAGAAACCCCCGCTGGCTCAGTGTCACCTGGCAAGACCCCCACTCCTGGAACTCATCTTTCTACAGACTACGGTTTGAGCTCAGATATCGGGCTGAACGGTCAAAGACATTCACAACATGGATGGTCAAGGACCTCCAGCATCACTGTGTCATCCACGACGCCTGGAGCGGCCTGAGGCACGTGGTGCAGCTTCGTGCCCAGGAGGAGTTCGGGCAAGGCGAGTGGAGCGAGTGGAGCCCGGAGGCCATGGGCACGCCTTGGACAGAATCCAGGAGTCCTCCAGCTGAGAACGAGGTGTCCACCCCCATGCAGGCACTTACTACTAATAAAGACGATGATAATATTCTCTTCAGAGATTCTGCAAATGCGACAAGCCTCCCAGTGCAAGATTCTTCTTCAGTACCACTGCCCACATTCCTGGTTGCTGGAGGGAGCCTGGCCTTCGGAACGCTCCTCTGCATTGCCATTGTTCTGAGGTTCAAGAAGACGTGGAAGCTGCGGGCTCTGAAGGAAGGCAAGACAAGCATGCATCCGCCGTACTCTTTGGGGCAGCTGGTCCCGGAGAGGCCTCGACCCACCCCAGTGCTTGTTCCTCTCATCTCCCCACCGGTGTCCCCCAGCAGCCTGGGGTCTGACAATACCTCGAGCCACAACCGACCAGATGCCAGGGACCCACGGAGCCCTTATGACATCAGCAATACAGACTACTTCTTCCCCAGATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-507 Pre-Made Sarilumab biosimilar, Whole mAb, Anti-IL6R Antibody: Anti-CD126/HIES5/IL-1Ra-1A/IL6Q/IL6QTL/gp80 therapeutic antibody
    Biosimilar GMP-Bios-ab-308 Pre-Made Levilimab biosimilar, Whole mAb, Anti-IL6R Antibody: Anti-CD126/HIES5/IL-1Ra-1A/IL6Q/IL6QTL/gp80 therapeutic antibody
    Biosimilar GMP-Bios-ab-509 Pre-Made Satralizumab biosimilar, Whole mAb, Anti-IL6R Antibody: Anti-CD126/HIES5/IL-1Ra-1A/IL6Q/IL6QTL/gp80 therapeutic antibody
    Biosimilar GMP-Bios-ab-584 Pre-Made Tocilizumab biosimilar, Whole mAb, Anti-IL6R Antibody: Anti-CD126/HIES5/IL-1Ra-1A/IL6Q/IL6QTL/gp80 therapeutic antibody
    Biosimilar GMP-Bios-ab-625 Pre-Made Vobarilizumab biosimilar, Bispecific Single Domains (VH-VH'), Anti-IL6R;ALB Antibody: Anti-CD126/HIES5/IL-1Ra/IL-6R/IL-6R-1/IL-6RA/IL6Q/IL6QTL/IL6RA/IL6RQ/gp80;FDAHT/HSA/PRO0883/PRO0903/PRO1341 therapeutic antibody
    Biosimilar GMP-Bios-ab-506 Pre-Made Sapelizumab biosimilar, Whole mAb, Anti-IL6R Antibody: Anti-CD126/HIES5/IL-1Ra-1A/IL6Q/IL6QTL/gp80 therapeutic antibody
    Target Antibody GM-Tg-g-TA027-Ab Anti-IL6RA/ IL6R/ CD126 monoclonal antibody
    Target Antigen GM-Tg-g-TA027-Ag IL6R VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-TA027 Interleukin 6 receptor (IL6R) protein & antibody
    ORF Viral Vector pGMLP000774 Human IL6R Lentivirus plasmid
    ORF Viral Vector vGMLP000774 Human IL6R Lentivirus particle
    ORF Viral Vector pGMLV002569 Mouse Il6ra Lentivirus plasmid
    ORF Viral Vector pGMLV002570 Human IL6R Lentivirus plasmid


    Target information

    Target ID GM-TA027
    Target Name IL6R
    Gene ID 3570, 16194, 716690, 24499, 101085689, 612271, 507359, 102148787
    Gene Symbol and Synonyms CD126,gp80,HIES5,IL-1Ra,IL-6R,IL-6R-1,IL-6R-alpha,IL-6RA,IL6Q,IL6QTL,IL6R,IL6R1,IL6RA,IL6RQ
    Uniprot Accession P08887
    Uniprot Entry Name IL6RA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Ovary Cancer, myeloma patients
    Gene Ensembl ENSG00000160712
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been identified in this gene. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.