Human CD80/B7/ B7-1 ORF/cDNA clone-Lentivirus plasmid (NM_005191)
Pre-made Human CD80/B7/ B7-1 Lentiviral expression plasmid for CD80 lentivirus packaging, CD80 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CD80/B7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000855 | Human CD80 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000855 |
Gene Name | CD80 |
Accession Number | NM_005191 |
Gene ID | 941 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 867 bp |
Gene Alias | B7, B7-1, B7.1, BB1, CD28LG, CD28LG1, LAB7 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCCACACACGGAGGCAGGGAACATCACCATCCAAGTGTCCATACCTCAATTTCTTTCAGCTCTTGGTGCTGGCTGGTCTTTCTCACTTCTGTTCAGGTGTTATCCACGTGACCAAGGAAGTGAAAGAAGTGGCAACGCTGTCCTGTGGTCACAATGTTTCTGTTGAAGAGCTGGCACAAACTCGCATCTACTGGCAAAAGGAGAAGAAAATGGTGCTGACTATGATGTCTGGGGACATGAATATATGGCCCGAGTACAAGAACCGGACCATCTTTGATATCACTAATAACCTCTCCATTGTGATCCTGGCTCTGCGCCCATCTGACGAGGGCACATACGAGTGTGTTGTTCTGAAGTATGAAAAAGACGCTTTCAAGCGGGAACACCTGGCTGAAGTGACGTTATCAGTCAAAGCTGACTTCCCTACACCTAGTATATCTGACTTTGAAATTCCAACTTCTAATATTAGAAGGATAATTTGCTCAACCTCTGGAGGTTTTCCAGAGCCTCACCTCTCCTGGTTGGAAAATGGAGAAGAATTAAATGCCATCAACACAACAGTTTCCCAAGATCCTGAAACTGAGCTCTATGCTGTTAGCAGCAAACTGGATTTCAATATGACAACCAACCACAGCTTCATGTGTCTCATCAAGTATGGACATTTAAGAGTGAATCAGACCTTCAACTGGAATACAACCAAGCAAGAGCATTTTCCTGATAACCTGCTCCCATCCTGGGCCATTACCTTAATCTCAGTAAATGGAATTTTTGTGATATGCTGCCTGACCTACTGCTTTGCCCCAAGATGCAGAGAGAGAAGGAGGAATGAGAGATTGAGAAGGGAAAGTGTACGCCCTGTATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-753 | Pre-Made Belatacept Biosimilar, Fusion Protein targeting CD80 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting B7/B7-1/B7.1/BB1/CD28LG/CD28LG1/LAB7 |
Biosimilar | GMP-Bios-ab-229 | Pre-Made Galiximab biosimilar, Whole mAb, Anti-CD80 Antibody: Anti-B7/BB1/B7-1/B7.1/LAB7/CD28LG/CD28LG1 therapeutic antibody |
Target Antibody | GM-Tg-g-T58238-Ab | Anti-CD80/ B7/ B7-1 monoclonal antibody |
Target Antigen | GM-Tg-g-T58238-Ag | CD80 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000855 | Human CD80 Lentivirus plasmid |
ORF Viral Vector | vGMLP000855 | Human CD80 Lentivirus particle |
ORF Viral Vector | pGMLV002224 | Mouse Cd80 Lentivirus plasmid |
Target information
Target ID | GM-T58238 |
Target Name | CD80 |
Gene ID | 941, 12519, 732518, 25408, 493786, 403765, 407131, 100071012 |
Gene Symbol and Synonyms | B7,B7-1,B7.1,B71,BB1,Cd28l,CD28LG,CD28LG1,CD80,LAB7,Ly-53,Ly53,MIC17,TSA1 |
Uniprot Accession | P33681 |
Uniprot Entry Name | CD80_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Lipoid nephrosis |
Gene Ensembl | ENSG00000121594 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.