Human CD80/B7/ B7-1 ORF/cDNA clone-Lentivirus particle (NM_005191)

Pre-made Human CD80/B7/ B7-1 Lentiviral expression plasmid for CD80 lentivirus packaging, CD80 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD80/B7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000855 Human CD80 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000855
Gene Name CD80
Accession Number NM_005191
Gene ID 941
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 867 bp
Gene Alias B7, B7-1, B7.1, BB1, CD28LG, CD28LG1, LAB7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCCACACACGGAGGCAGGGAACATCACCATCCAAGTGTCCATACCTCAATTTCTTTCAGCTCTTGGTGCTGGCTGGTCTTTCTCACTTCTGTTCAGGTGTTATCCACGTGACCAAGGAAGTGAAAGAAGTGGCAACGCTGTCCTGTGGTCACAATGTTTCTGTTGAAGAGCTGGCACAAACTCGCATCTACTGGCAAAAGGAGAAGAAAATGGTGCTGACTATGATGTCTGGGGACATGAATATATGGCCCGAGTACAAGAACCGGACCATCTTTGATATCACTAATAACCTCTCCATTGTGATCCTGGCTCTGCGCCCATCTGACGAGGGCACATACGAGTGTGTTGTTCTGAAGTATGAAAAAGACGCTTTCAAGCGGGAACACCTGGCTGAAGTGACGTTATCAGTCAAAGCTGACTTCCCTACACCTAGTATATCTGACTTTGAAATTCCAACTTCTAATATTAGAAGGATAATTTGCTCAACCTCTGGAGGTTTTCCAGAGCCTCACCTCTCCTGGTTGGAAAATGGAGAAGAATTAAATGCCATCAACACAACAGTTTCCCAAGATCCTGAAACTGAGCTCTATGCTGTTAGCAGCAAACTGGATTTCAATATGACAACCAACCACAGCTTCATGTGTCTCATCAAGTATGGACATTTAAGAGTGAATCAGACCTTCAACTGGAATACAACCAAGCAAGAGCATTTTCCTGATAACCTGCTCCCATCCTGGGCCATTACCTTAATCTCAGTAAATGGAATTTTTGTGATATGCTGCCTGACCTACTGCTTTGCCCCAAGATGCAGAGAGAGAAGGAGGAATGAGAGATTGAGAAGGGAAAGTGTACGCCCTGTATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-753 Pre-Made Belatacept Biosimilar, Fusion Protein targeting CD80 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting B7/B7-1/B7.1/BB1/CD28LG/CD28LG1/LAB7
    Biosimilar GMP-Bios-ab-229 Pre-Made Galiximab biosimilar, Whole mAb, Anti-CD80 Antibody: Anti-B7/BB1/B7-1/B7.1/LAB7/CD28LG/CD28LG1 therapeutic antibody
    Target Antibody GM-Tg-g-T58238-Ab Anti-CD80/ B7/ B7-1 monoclonal antibody
    Target Antigen GM-Tg-g-T58238-Ag CD80 VLP (virus-like particle)
    ORF Viral Vector pGMLP000855 Human CD80 Lentivirus plasmid
    ORF Viral Vector vGMLP000855 Human CD80 Lentivirus particle
    ORF Viral Vector pGMLV002224 Mouse Cd80 Lentivirus plasmid


    Target information

    Target ID GM-T58238
    Target Name CD80
    Gene ID 941, 12519, 732518, 25408, 493786, 403765, 407131, 100071012
    Gene Symbol and Synonyms B7,B7-1,B7.1,B71,BB1,Cd28l,CD28LG,CD28LG1,CD80,LAB7,Ly-53,Ly53,MIC17,TSA1
    Uniprot Accession P33681
    Uniprot Entry Name CD80_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Lipoid nephrosis
    Gene Ensembl ENSG00000121594
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.