Human AGTRAP/ATRAP ORF/cDNA clone-Lentivirus plasmid (NM_001040194)

Cat. No.: pGMLP000862
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AGTRAP/ATRAP Lentiviral expression plasmid for AGTRAP lentivirus packaging, AGTRAP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AGTRAP/ATRAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000862
Gene Name AGTRAP
Accession Number NM_001040194
Gene ID 57085
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 459 bp
Gene Alias ATRAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCTGCCTGCTGTGAACCTGAAGGTGATTCTCCTAGGTCACTGGCTGCTGACAACCTGGGGCTGCATTGTATTCTCAGGCTCCTATGCCTGGGCCAACTTCACCATCCTGGCCTTGGGCGTGTGGGCTGTGGCTCAGCGGGACTCCATCGACGCCATAAGCATGTTTCTGGGTGGCTTGCTGGCCACCATCTTCCTGGACATCGTGCACATCAGCATCTTCTACCCGCGGGTCAGCCTCACGGACACGGGCCGCTTTGGCGTGGGCATGGCCATCCTCAGCTTGCTGCTCAAGCCGCTCTCCTGCTGCTTCGTCTACCACATGTACCGGGAGCGCGGGGGTTTCCTTGGGTCTTCTCAGGACCGTAGTGCCTACCAGACGATTGACTCAGCAGAGGCGCCCGCAGATCCCTTTGCAGTCCCAGAGGGCAGGAGTCAAGATGCCCGAGGGTACTGA
ORF Protein Sequence MELPAVNLKVILLGHWLLTTWGCIVFSGSYAWANFTILALGVWAVAQRDSIDAISMFLGGLLATIFLDIVHISIFYPRVSLTDTGRFGVGMAILSLLLKPLSCCFVYHMYRERGGFLGSSQDRSAYQTIDSAEAPADPFAVPEGRSQDARGY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0048-Ab Anti-ATRAP/ AGTRAP monoclonal antibody
    Target Antigen GM-Tg-g-MP0048-Ag AGTRAP VLP (virus-like particle)
    ORF Viral Vector pGMLP000862 Human AGTRAP Lentivirus plasmid
    ORF Viral Vector pGMLP001187 Human AGTRAP Lentivirus plasmid
    ORF Viral Vector vGMLP000862 Human AGTRAP Lentivirus particle
    ORF Viral Vector vGMLP001187 Human AGTRAP Lentivirus particle


    Target information

    Target ID GM-MP0048
    Target Name AGTRAP
    Gene ID 57085, 11610, 722746, 298646, 102901287, 608333, 508521, 100051052
    Gene Symbol and Synonyms 3300002E14Rik,AGTRAP,AT1R,ATRAP,D4Wsu124e
    Uniprot Accession Q6RW13
    Uniprot Entry Name ATRAP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000177674
    Target Classification Not Available

    This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.