Human AGTRAP/ATRAP ORF/cDNA clone-Lentivirus particle (NM_020350)
Cat. No.: vGMLP001187
Pre-made Human AGTRAP/ATRAP Lentiviral expression plasmid for AGTRAP lentivirus packaging, AGTRAP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
AGTRAP/ATRAP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001187 | Human AGTRAP Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001187 |
| Gene Name | AGTRAP |
| Accession Number | NM_020350 |
| Gene ID | 57085 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 480 bp |
| Gene Alias | ATRAP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGCTGCCTGCTGTGAACCTGAAGGTGATTCTCCTAGGTCACTGGCTGCTGACAACCTGGGGCTGCATTGTATTCTCAGGCTCCTATGCCTGGGCCAACTTCACCATCCTGGCCTTGGGCGTGTGGGCTGTGGCTCAGCGGGACTCCATCGACGCCATAAGCATGTTTCTGGGTGGCTTGCTGGCCACCATCTTCCTGGACATCGTGCACATCAGCATCTTCTACCCGCGGGTCAGCCTCACGGACACGGGCCGCTTTGGCGTGGGCATGGCCATCCTCAGCTTGCTGCTCAAGCCGCTCTCCTGCTGCTTCGTCTACCACATGTACCGGGAGCGCGGGGGTGAGCTCCTGGTCCACACTGGTTTCCTTGGGTCTTCTCAGGACCGTAGTGCCTACCAGACGATTGACTCAGCAGAGGCGCCCGCAGATCCCTTTGCAGTCCCAGAGGGCAGGAGTCAAGATGCCCGAGGGTACTGA |
| ORF Protein Sequence | MELPAVNLKVILLGHWLLTTWGCIVFSGSYAWANFTILALGVWAVAQRDSIDAISMFLGGLLATIFLDIVHISIFYPRVSLTDTGRFGVGMAILSLLLKPLSCCFVYHMYRERGGELLVHTGFLGSSQDRSAYQTIDSAEAPADPFAVPEGRSQDARGY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0048-Ab | Anti-ATRAP/ AGTRAP monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0048-Ag | AGTRAP VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000862 | Human AGTRAP Lentivirus plasmid |
| ORF Viral Vector | pGMLP001187 | Human AGTRAP Lentivirus plasmid |
| ORF Viral Vector | vGMLP000862 | Human AGTRAP Lentivirus particle |
| ORF Viral Vector | vGMLP001187 | Human AGTRAP Lentivirus particle |
Target information
| Target ID | GM-MP0048 |
| Target Name | AGTRAP |
| Gene ID | 57085, 11610, 722746, 298646, 102901287, 608333, 508521, 100051052 |
| Gene Symbol and Synonyms | 3300002E14Rik,AGTRAP,AT1R,ATRAP,D4Wsu124e |
| Uniprot Accession | Q6RW13 |
| Uniprot Entry Name | ATRAP_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000177674 |
| Target Classification | Not Available |
This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


