Human PARD6A/PAR-6A/PAR6 ORF/cDNA clone-Lentivirus plasmid (NM_016948)

Cat. No.: pGMLP001412
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PARD6A/PAR-6A/PAR6 Lentiviral expression plasmid for PARD6A lentivirus packaging, PARD6A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PARD6A/PAR-6A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $591.48
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001412
Gene Name PARD6A
Accession Number NM_016948
Gene ID 50855
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1041 bp
Gene Alias PAR-6A,PAR6,PAR6alpha,PAR6C,TAX40,TIP-40
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCGGCCGCAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACGCCGAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGGTTGCTGCGGGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCTCATGGCGACCTGCTGCCCCTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGGCCCCCGCCACTGCGCCTACTGGTGCAGAAGCGGGCAGAAGCTGACTCCAGCGGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGGCCAGTGGCACCCCTGCGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAGGTTTCCTCAGTCATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTTCAGACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGCCTGGAGCGGGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGTACAGGGCTGCTGGCGGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGGAAGACCTTGGACCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGGGGCATCTGGGCGTTTGACAGGTCCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGACAGCAGTGACCTGGTCATTGAGAACCGCCAGCCTCCCAGTTCCAATGGGCTGTCTCAGGGGCCCCCGTGCTGGGACCTGCACCCTGGCTGCCGACATCCTGGTACCCGCAGCTCTCTGCCCTCCCTGGATGACCAGGAGCAGGCCAGTTCTGGCTGGGGGAGTCGCATTCGAGGAGATGGTAGTGGCTTCAGCCTCTGA
ORF Protein Sequence MARPQRTPARSPDSIVEVKSKFDAEFRRFALPRASVSGFQEFSRLLRAVHQIPGLDVLLGYTDAHGDLLPLTNDDSLHRALASGPPPLRLLVQKRAEADSSGLAFASNSLQRRKKGLLLRPVAPLRTRPPLLISLPQDFRQVSSVIDVDLLPETHRRVRLHKHGSDRPLGFYIRDGMSVRVAPQGLERVPGIFISRLVRGGLAESTGLLAVSDEILEVNGIEVAGKTLDQVTDMMVANSHNLIVTVKPANQRNNVVRGASGRLTGPPSAGPGPAEPDSDDDSSDLVIENRQPPSSNGLSQGPPCWDLHPGCRHPGTRSSLPSLDDQEQASSGWGSRIRGDGSGFSL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2234-Ab Anti-PAR6A/ PARD6A/ PAR-6A monoclonal antibody
    Target Antigen GM-Tg-g-MP2234-Ag PARD6A VLP (virus-like particle)
    ORF Viral Vector pGMLP001412 Human PARD6A Lentivirus plasmid
    ORF Viral Vector vGMLP001412 Human PARD6A Lentivirus particle


    Target information

    Target ID GM-MP2234
    Target Name PARD6A
    Gene ID 50855, 56513, 699351, 307799, 101101605, 489756, 524653, 100053411
    Gene Symbol and Synonyms 0710008C04Rik,2610010A15Rik,Par-6,PAR-6A,PAR6,Par6a,PAR6alpha,PAR6C,PARD6A,TAX40,TIP-40
    Uniprot Accession Q9NPB6
    Uniprot Entry Name PAR6A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102981
    Target Classification Not Available

    This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.