Human PARD6A/PAR-6A/PAR6 ORF/cDNA clone-Lentivirus particle (NM_016948)
Cat. No.: vGMLP001412
Pre-made Human PARD6A/PAR-6A/PAR6 Lentiviral expression plasmid for PARD6A lentivirus packaging, PARD6A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PARD6A/PAR-6A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001412 | Human PARD6A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001412 |
Gene Name | PARD6A |
Accession Number | NM_016948 |
Gene ID | 50855 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1041 bp |
Gene Alias | PAR-6A,PAR6,PAR6alpha,PAR6C,TAX40,TIP-40 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCCGGCCGCAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACGCCGAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGGTTGCTGCGGGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCTCATGGCGACCTGCTGCCCCTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGGCCCCCGCCACTGCGCCTACTGGTGCAGAAGCGGGCAGAAGCTGACTCCAGCGGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGGCCAGTGGCACCCCTGCGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAGGTTTCCTCAGTCATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTTCAGACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGCCTGGAGCGGGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGTACAGGGCTGCTGGCGGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGGAAGACCTTGGACCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGGGGCATCTGGGCGTTTGACAGGTCCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGACAGCAGTGACCTGGTCATTGAGAACCGCCAGCCTCCCAGTTCCAATGGGCTGTCTCAGGGGCCCCCGTGCTGGGACCTGCACCCTGGCTGCCGACATCCTGGTACCCGCAGCTCTCTGCCCTCCCTGGATGACCAGGAGCAGGCCAGTTCTGGCTGGGGGAGTCGCATTCGAGGAGATGGTAGTGGCTTCAGCCTCTGA |
ORF Protein Sequence | MARPQRTPARSPDSIVEVKSKFDAEFRRFALPRASVSGFQEFSRLLRAVHQIPGLDVLLGYTDAHGDLLPLTNDDSLHRALASGPPPLRLLVQKRAEADSSGLAFASNSLQRRKKGLLLRPVAPLRTRPPLLISLPQDFRQVSSVIDVDLLPETHRRVRLHKHGSDRPLGFYIRDGMSVRVAPQGLERVPGIFISRLVRGGLAESTGLLAVSDEILEVNGIEVAGKTLDQVTDMMVANSHNLIVTVKPANQRNNVVRGASGRLTGPPSAGPGPAEPDSDDDSSDLVIENRQPPSSNGLSQGPPCWDLHPGCRHPGTRSSLPSLDDQEQASSGWGSRIRGDGSGFSL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2234-Ab | Anti-PAR6A/ PARD6A/ PAR-6A monoclonal antibody |
Target Antigen | GM-Tg-g-MP2234-Ag | PARD6A VLP (virus-like particle) |
ORF Viral Vector | pGMLP001412 | Human PARD6A Lentivirus plasmid |
ORF Viral Vector | vGMLP001412 | Human PARD6A Lentivirus particle |
Target information
Target ID | GM-MP2234 |
Target Name | PARD6A |
Gene ID | 50855, 56513, 699351, 307799, 101101605, 489756, 524653, 100053411 |
Gene Symbol and Synonyms | 0710008C04Rik,2610010A15Rik,Par-6,PAR-6A,PAR6,Par6a,PAR6alpha,PAR6C,PARD6A,TAX40,TIP-40 |
Uniprot Accession | Q9NPB6 |
Uniprot Entry Name | PAR6A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000102981 |
Target Classification | Not Available |
This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.