Human GFRA3/GDNFR3 ORF/cDNA clone-Lentivirus plasmid (NM_001496)

Pre-made Human GFRA3/GDNFR3 Lentiviral expression plasmid for GFRA3 lentivirus packaging, GFRA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GFRA3/GDNFR3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001514 Human GFRA3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001514
Gene Name GFRA3
Accession Number NM_001496
Gene ID 2676
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1203 bp
Gene Alias GDNFR3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGCGCCCCCTGAACCCGCGACCGCTGCCGCCCGTAGTCCTGATGTTGCTGCTGCTGCTGCCGCCGTCGCCGCTGCCTCTCGCAGCCGGAGACCCCCTTCCCACAGAAAGCCGACTCATGAACAGCTGTCTCCAGGCCAGGAGGAAGTGCCAGGCTGATCCCACCTGCAGTGCTGCCTACCACCACCTGGATTCCTGCACCTCTAGCATAAGCACCCCACTGCCCTCAGAGGAGCCTTCGGTCCCTGCTGACTGCCTGGAGGCAGCACAGCAACTCAGGAACAGCTCTCTGATAGGCTGCATGTGCCACCGGCGCATGAAGAACCAGGTTGCCTGCTTGGACATCTATTGGACCGTTCACCGTGCCCGCAGCCTTGGTAACTATGAGCTGGATGTCTCCCCCTATGAAGACACAGTGACCAGCAAACCCTGGAAAATGAATCTCAGCAAACTGAACATGCTCAAACCAGACTCAGACCTCTGCCTCAAGTTTGCCATGCTGTGTACTCTCAATGACAAGTGTGACCGGCTGCGCAAGGCCTACGGGGAGGCGTGCTCCGGGCCCCACTGCCAGCGCCACGTCTGCCTCAGGCAGCTGCTCACTTTCTTCGAGAAGGCCGCCGAGCCCCACGCGCAGGGCCTGCTACTGTGCCCATGTGCCCCCAACGACCGGGGCTGCGGGGAGCGCCGGCGCAACACCATCGCCCCCAACTGCGCGCTGCCGCCTGTGGCCCCCAACTGCCTGGAGCTGCGGCGCCTCTGCTTCTCCGACCCGCTTTGCAGATCACGCCTGGTGGATTTCCAGACCCACTGCCATCCCATGGACATCCTAGGAACTTGTGCAACAGAGCAGTCCAGATGTCTACGAGCATACCTGGGGCTGATTGGGACTGCCATGACCCCCAACTTTGTCAGCAATGTCAACACCAGTGTTGCCTTAAGCTGCACCTGCCGAGGCAGTGGCAACCTGCAGGAGGAGTGTGAAATGCTGGAAGGGTTCTTCTCCCACAACCCCTGCCTCACGGAGGCCATTGCAGCTAAGATGCGTTTTCACAGCCAACTCTTCTCCCAGGACTGGCCACACCCTACCTTTGCTGTGATGGCACACCAGAATGAAAACCCTGCTGTGAGGCCACAGCCCTGGGTGCCCTCTCTTTTCTCCTGCACGCTTCCCTTGATTCTGCTCCTGAGCCTATGGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-361 Pre-Made Nadecnemab biosimilar, Whole mAb, Anti-GFRA3 Antibody: Anti-GDNFR3 therapeutic antibody
    Target Antibody GM-Tg-g-T92042-Ab Anti-GFRA3/ GDNFR3 monoclonal antibody
    Target Antigen GM-Tg-g-T92042-Ag GFRA3 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T92042 GDNF family receptor alpha 3 (GFRA3) protein & antibody
    ORF Viral Vector pGMLP001514 Human GFRA3 Lentivirus plasmid
    ORF Viral Vector vGMLP001514 Human GFRA3 Lentivirus particle


    Target information

    Target ID GM-T92042
    Target Name GFRA3
    Gene ID 2676, 14587, 714050, 84422, 101086693, 481527, 540009, 100072589
    Gene Symbol and Synonyms GDNFR3,GFRA3,GFRalpha3
    Uniprot Accession O60609
    Uniprot Entry Name GFRA3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000146013
    Target Classification Not Available

    The protein encoded by this gene is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor and a member of the GDNF receptor family. It forms a signaling receptor complex with RET tyrosine kinase receptor and binds the ligand, artemin. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.