Human GFRA3/GDNFR3 ORF/cDNA clone-Lentivirus plasmid (NM_001496)
Pre-made Human GFRA3/GDNFR3 Lentiviral expression plasmid for GFRA3 lentivirus packaging, GFRA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GFRA3/GDNFR3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001514 | Human GFRA3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001514 |
Gene Name | GFRA3 |
Accession Number | NM_001496 |
Gene ID | 2676 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1203 bp |
Gene Alias | GDNFR3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGCGCCCCCTGAACCCGCGACCGCTGCCGCCCGTAGTCCTGATGTTGCTGCTGCTGCTGCCGCCGTCGCCGCTGCCTCTCGCAGCCGGAGACCCCCTTCCCACAGAAAGCCGACTCATGAACAGCTGTCTCCAGGCCAGGAGGAAGTGCCAGGCTGATCCCACCTGCAGTGCTGCCTACCACCACCTGGATTCCTGCACCTCTAGCATAAGCACCCCACTGCCCTCAGAGGAGCCTTCGGTCCCTGCTGACTGCCTGGAGGCAGCACAGCAACTCAGGAACAGCTCTCTGATAGGCTGCATGTGCCACCGGCGCATGAAGAACCAGGTTGCCTGCTTGGACATCTATTGGACCGTTCACCGTGCCCGCAGCCTTGGTAACTATGAGCTGGATGTCTCCCCCTATGAAGACACAGTGACCAGCAAACCCTGGAAAATGAATCTCAGCAAACTGAACATGCTCAAACCAGACTCAGACCTCTGCCTCAAGTTTGCCATGCTGTGTACTCTCAATGACAAGTGTGACCGGCTGCGCAAGGCCTACGGGGAGGCGTGCTCCGGGCCCCACTGCCAGCGCCACGTCTGCCTCAGGCAGCTGCTCACTTTCTTCGAGAAGGCCGCCGAGCCCCACGCGCAGGGCCTGCTACTGTGCCCATGTGCCCCCAACGACCGGGGCTGCGGGGAGCGCCGGCGCAACACCATCGCCCCCAACTGCGCGCTGCCGCCTGTGGCCCCCAACTGCCTGGAGCTGCGGCGCCTCTGCTTCTCCGACCCGCTTTGCAGATCACGCCTGGTGGATTTCCAGACCCACTGCCATCCCATGGACATCCTAGGAACTTGTGCAACAGAGCAGTCCAGATGTCTACGAGCATACCTGGGGCTGATTGGGACTGCCATGACCCCCAACTTTGTCAGCAATGTCAACACCAGTGTTGCCTTAAGCTGCACCTGCCGAGGCAGTGGCAACCTGCAGGAGGAGTGTGAAATGCTGGAAGGGTTCTTCTCCCACAACCCCTGCCTCACGGAGGCCATTGCAGCTAAGATGCGTTTTCACAGCCAACTCTTCTCCCAGGACTGGCCACACCCTACCTTTGCTGTGATGGCACACCAGAATGAAAACCCTGCTGTGAGGCCACAGCCCTGGGTGCCCTCTCTTTTCTCCTGCACGCTTCCCTTGATTCTGCTCCTGAGCCTATGGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-361 | Pre-Made Nadecnemab biosimilar, Whole mAb, Anti-GFRA3 Antibody: Anti-GDNFR3 therapeutic antibody |
Target Antibody | GM-Tg-g-T92042-Ab | Anti-GFRA3/ GDNFR3 monoclonal antibody |
Target Antigen | GM-Tg-g-T92042-Ag | GFRA3 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T92042 | GDNF family receptor alpha 3 (GFRA3) protein & antibody |
ORF Viral Vector | pGMLP001514 | Human GFRA3 Lentivirus plasmid |
ORF Viral Vector | vGMLP001514 | Human GFRA3 Lentivirus particle |
Target information
Target ID | GM-T92042 |
Target Name | GFRA3 |
Gene ID | 2676, 14587, 714050, 84422, 101086693, 481527, 540009, 100072589 |
Gene Symbol and Synonyms | GDNFR3,GFRA3,GFRalpha3 |
Uniprot Accession | O60609 |
Uniprot Entry Name | GFRA3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000146013 |
Target Classification | Not Available |
The protein encoded by this gene is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor and a member of the GDNF receptor family. It forms a signaling receptor complex with RET tyrosine kinase receptor and binds the ligand, artemin. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.